ORFeome > LOC594871 ORF1 – XORFeome v1.0

LOC594871 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6465967
Gene Page ID:
ORF Xenbase ID: 17256705

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082898
Original XGC clone length: 723

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ839708
dbEST ID: 79657410
Trimmed Sequence: ATGTCCTGGGCTGTCCTCCTCCTCTCTCTCACCTCTCTCTGTACATATTCAGCCGCCCAAGTCTCTCTTACTCAGCCAGTGTCTGAATCAGTGAAATTGGGGGAGACAGTGAGAATCTCCTGCACACTCAGTGGTTACAGTATCAGTGATCGTGCTGTGCACTGGTTCCAGCAGAAAGCAGGGAATCGCCCCAGATACTTACTGTGGTTTAATTCTGACTCAAGCAAACACCAGGGAGATGGGGTACCTGATCGGTTCTCTGGATCCAAAGATTCCCCTAATAATGTTGGCTATTTAACCATTAAAGGAGCCTTACTAGAAGATGATGCAGATTATTACTGTGCTATATGGTATTCCAGCTCGTTGCATATCTTTGGAGGTGGAACCCAGCTGACTGTCCTTACAGGTGACGTGAAAGCCCCTTCAGTGTCCATCTTTCCTCCCTCCGTGGAAGAAATAGCCACCAAAAAGGCAACAGTGGTCTGCAGTCTGAGTGATTTCACCCCCAGAGGTGCCACAGTGAAGTGGCTGGTGGATGGGAAAGATCAGACTGACAGTGTTCAGTCCTCANGGCTCAGCAAACAGAGTGACAACCTGTATATGGAGAGCAGTTATCTGTCCCTGACAGCAGATCAATGGCTCAGACATGAAACCTATTCTTGCAAAGTCTCCCATCAAGGCAAGGAAATAATCCAGACGCTAAAGAGACCCAAATGTGTAATGCCCACTTTTCTTGTAACAAATTGGCATTAATAAAAAAGCATTGCTTTATCAATTTGTTTGCAACAAAAAAGGTCACTTATAAGTCCAAAAAAAAATTCATTTA
Full Trace Sequence: CCGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCTGGGCTGTCCTCCTCCTCTCTCTCACCTCTCTCTGTACATATTCAGCCGCCCAAGTCTCTCTTACTCAGCCAGTGTCTGAATCAGTGAAATTGGGGGAGACAGTGAGAATCTCCTGCACACTCAGTGGTTACAGTATCAGTGATCGTGCTGTGCACTGGTTCCAGCAGAAAGCAGGGAATCGCCCCAGATACTTACTGTGGTTTAATTCTGACTCAAGCAAACACCAGGGAGATGGGGTACCTGATCGGTTCTCTGGATCCAAAGATTCCCCTAATAATGTTGGCTATTTAACCATTAAAGGAGCCTTACTAGAAGATGATGCAGATTATTACTGTGCTATATGGTATTCCAGCTCGTTGCATATCTTTGGAGGTGGAACCCAGCTGACTGTCCTTACAGGTGACGTGAAAGCCCCTTCAGTGTCCATCTTTCCTCCCTCCGTGGAAGAAATAGCCACCAAAAAGGCAACAGTGGTCTGCAGTCTGAGTGATTTCACCCCCAGAGGTGCCACAGTGAAGTGGCTGGTGGATGGGAAAGATCAGACTGACAGTGTTCAGTCCTCANGGCTCAGCAAACAGAGTGACAACCTGTATATGGAGAGCAGTTATCTGTCCCTGACAGCAGATCAATGGCTCAGACATGAAACCTATTCTTGCAAAGTCTCCCATCAAGGCAAGGAAATAATCCAGACGCTAAAGAGACCCAAATGTGTAATGCCCACTTTTCTTGTAACAAATTGGCATTAATAAAAAAGCATTGCTTTATCAATTTGTTTGCAACAAAAAAGGTCACTTATAAGTCCAAAAAAAAATTCATTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTGGGCTGTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839707
dbEST ID: 79657409
Trimmed Sequence: TACACATTCGGATCTCTTCAGCGTCTGGATTATTTCCTTGCCTTGATGGGAGACTTTGCAAGAATAGGTTTCATGTCTGAGCCATTGATCTGCTGTCAGGGACAGATAACTGCTCTCCATATACAGGTTGTCACTCTGTTTGCTGAGCCCTGAGGACTGAACACTGTCAGTCTGATCTTTCCCATCCACCAGCCACTTCACTGTGGCACCTCTGGGGGTGAAATCACTCAGACTGCAGACCACTGTTGCCTTTTTGGTGGCTATTTCTTCCACGGAGGGAGGAAAGATGGACACTGAAGGGGCTTTCACGTCACCTGTAAGGACAGTCAGCTGGGTTCCACCTCCAAAGATATGCAACGAGCTGGAATACCATATAGCACAGTAATAATCTGCATCATCTTCTAGTAAGGCTCCTTTAATGGTTAAATAGCCAACATTATTAGGGGAATCTTTGGATCCAGAGAACCGATCAGGTACCCCATCTCCCTGGTGTTTGCTTGAGTCAGAATTAAACCACAGTAAGTATCTGGGGGCGATTCCCTGCTTTCTGCTGGAACCAGTGCACAGCAGGATCACTGATACTGTAACCCCCTGAGTGTGCAAGGAGATTCTCACCTGTCTCCCCCCATTTCACTGGAATCAAACCCTGGCTGAATAAAAAAAAAATTTGGGGCGCTGAAAAATGTAACCAAAAAAGGTGAAGAAAAAGAGAAAAAGAACACCCCAAGAAAAGTGGTTGCCACTTTTTTTTTGCAAAAAGATTGGGGTATTTAAAAAAGA
Full Trace Sequence: AAAAGGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACACATTCGGATCTCTTCAGCGTCTGGATTATTTCCTTGCCTTGATGGGAGACTTTGCAAGAATAGGTTTCATGTCTGAGCCATTGATCTGCTGTCAGGGACAGATAACTGCTCTCCATATACAGGTTGTCACTCTGTTTGCTGAGCCCTGAGGACTGAACACTGTCAGTCTGATCTTTCCCATCCACCAGCCACTTCACTGTGGCACCTCTGGGGGTGAAATCACTCAGACTGCAGACCACTGTTGCCTTTTTGGTGGCTATTTCTTCCACGGAGGGAGGAAAGATGGACACTGAAGGGGCTTTCACGTCACCTGTAAGGACAGTCAGCTGGGTTCCACCTCCAAAGATATGCAACGAGCTGGAATACCATATAGCACAGTAATAATCTGCATCATCTTCTAGTAAGGCTCCTTTAATGGTTAAATAGCCAACATTATTAGGGGAATCTTTGGATCCAGAGAACCGATCAGGTACCCCATCTCCCTGGTGTTTGCTTGAGTCAGAATTAAACCACAGTAAGTATCTGGGGGCGATTCCCTGCTTTCTGCTGGAACCAGTGCACAGCAGGATCACTGATACTGTAACCCCCTGAGTGTGCAAGGAGATTCTCACCTGTCTCCCCCCATTTCACTGGAATCAAACCCTGGCTGAATAAAAAAAAAATTTGGGGCGCTGAAAAATGTAACCAAAAAAGGTGAAGAAAAAGAGAAAAAGAACACCCCAAGAAAAGTGGTTGCCACTTTTTTTTTGCAAAAAGATTGGGGTATTTAAAAAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACACATTCGGATCTCTTCAG