ORFeome > LOC594871 ORF2 – XORFeome v1.0

LOC594871 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6465967
Gene Page ID:
ORF Xenbase ID: 17256711

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084875
Original XGC clone length: 702

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: C02

Sequences - 5ʹ (forward) EST

Accession: JZ839974
dbEST ID: 79657676
Trimmed Sequence: ATGTCCTGGACAATCCCCCTCCTCACTCTGATGTCTCTGTGCACTTGTTGTGCCGGACAGTATGTGCTGACTCAGCCTGCATCTGTGAGTGTGAGTGTGGGAGGCACAGTGACACTCACTTGTCAAGGGAACAATATTGGCAGCAAGAATGTGTACTGGTATCAACAAATACTACCCAGTGTCCCCAGGCTCATCATATATGACGACAGCAAAAGACCTGATGGGATCCCAGAACGATTTTCTGGCACAAACTCTGGTAACACTGCAAGTTTAAAGATCTCTGGAGCCCAAGGAGAGGACGAGGCTGATTATTACTGTCAGGTGTGGGATAACGATAGCGATGCTGCTATCTTTGGAGGTGGAACCCAGCTGACTGTCCTTACAGGTGACGTGAAAGCCCCTTCAGTGTCCATCTTTCCTCCCTCCGTGGAAGAAATAGCCACCAAAAAGGCAACAGTGGTCTGCAGTCTGAGTGATTTCACCCCCAGAGGTGCCACAGTGAAGTGGCTGGTGGATGGGAAAGATCAGACTGAAAGTGTTCAGTCCTCAGGGCTCAACAAACAGAGTGACAACCTGTATATGGAGAGCAATTATCTGTCCCCTGACAGCAGATCAATGGCTCAGAAATGAAACCAATTCTTGCAAAGTCCCCCATCAAGGCAAGGAAATATTCCCAAACCCTGAAAAAAATCCAAATGTGAATTGCCACATTTCTTGTTACAAAATTGGCATTTATAAAAAAGCATTGTTTAAAAATTTGTTGTGCACCGAAAAGGGTTCCATATCAATTCAAAAAT
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCTGGACAATCCCCCTCCTCACTCTGATGTCTCTGTGCACTTGTTGTGCCGGACAGTATGTGCTGACTCAGCCTGCATCTGTGAGTGTGAGTGTGGGAGGCACAGTGACACTCACTTGTCAAGGGAACAATATTGGCAGCAAGAATGTGTACTGGTATCAACAAATACTACCCAGTGTCCCCAGGCTCATCATATATGACGACAGCAAAAGACCTGATGGGATCCCAGAACGATTTTCTGGCACAAACTCTGGTAACACTGCAAGTTTAAAGATCTCTGGAGCCCAAGGAGAGGACGAGGCTGATTATTACTGTCAGGTGTGGGATAACGATAGCGATGCTGCTATCTTTGGAGGTGGAACCCAGCTGACTGTCCTTACAGGTGACGTGAAAGCCCCTTCAGTGTCCATCTTTCCTCCCTCCGTGGAAGAAATAGCCACCAAAAAGGCAACAGTGGTCTGCAGTCTGAGTGATTTCACCCCCAGAGGTGCCACAGTGAAGTGGCTGGTGGATGGGAAAGATCAGACTGAAAGTGTTCAGTCCTCAGGGCTCAACAAACAGAGTGACAACCTGTATATGGAGAGCAATTATCTGTCCCCTGACAGCAGATCAATGGCTCAGAAATGAAACCAATTCTTGCAAAGTCCCCCATCAAGGCAAGGAAATATTCCCAAACCCTGAAAAAAATCCAAATGTGAATTGCCACATTTCTTGTTACAAAATTGGCATTTATAAAAAAGCATTGTTTAAAAATTTGTTGTGCACCGAAAAGGGTTCCATATCAATTCAAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTGGACAATCCCCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839973
dbEST ID: 79657675
Trimmed Sequence: TACACATTCGGATCTCTTCAGCGTCTGGATTATTTCCTTGCCTTGATGGGAGACTTTGCAAGAATAGGTTTCATGTCTGAGCCATTGATCTGCTGTCAGGGACAGATAACTGCTCTCCATATACAGGTTGTCACTCTGTTTGCTGAGCCCTGAGGACTGAACACTGTCAGTCTGATCTTTCCCATCCACCAGCCACTTCACTGTGGCACCTCTGGGGGTGAAATCACTCAGACTGCAGACCACTGTTGCCTTTTTGGTGGCTATTTCTTCCACGGAGGGAGGAAAGATGGACACTGAAGGGGCTTTCACGTCACCTGTAAGGACAGTCAGCTGGGTTCCACCTCCNAAGATAGCAGCATCGCTATCGTTATCCCACACCTGACAGTAATAATCAGCCTCGTCCTCTCCTTGGGCTCCAGAGATCTTTAAACTTGCAGTGTTACCAGAGTTTGTGCCAGAAAATCGTTCTGGGATCCCATCACGTCTTTTGCTGTCGTCATATATGATGGAACCTGGGGACACTGGGTAGTATTTGTTGATACGAGTACACATTCTTGCTGCCAATATTGTTCCCTTTGACAGTGGGTGTCCCTGTTGCCTCAACACTCCCCCTCGGAATGCAAGGCGGAGTCCGCCATACTGTTCGAGAGGAGAAAGTGCACAGAGACGTTCGAATTGAAGAAAGGGGATTGTGCCGGGACTTGGGTCCCGACCTTTTTTCTGTCCAAATTTGGGCATAAA
Full Trace Sequence: AAAGAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACACATTCGGATCTCTTCAGCGTCTGGATTATTTCCTTGCCTTGATGGGAGACTTTGCAAGAATAGGTTTCATGTCTGAGCCATTGATCTGCTGTCAGGGACAGATAACTGCTCTCCATATACAGGTTGTCACTCTGTTTGCTGAGCCCTGAGGACTGAACACTGTCAGTCTGATCTTTCCCATCCACCAGCCACTTCACTGTGGCACCTCTGGGGGTGAAATCACTCAGACTGCAGACCACTGTTGCCTTTTTGGTGGCTATTTCTTCCACGGAGGGAGGAAAGATGGACACTGAAGGGGCTTTCACGTCACCTGTAAGGACAGTCAGCTGGGTTCCACCTCCNAAGATAGCAGCATCGCTATCGTTATCCCACACCTGACAGTAATAATCAGCCTCGTCCTCTCCTTGGGCTCCAGAGATCTTTAAACTTGCAGTGTTACCAGAGTTTGTGCCAGAAAATCGTTCTGGGATCCCATCACGTCTTTTGCTGTCGTCATATATGATGGAACCTGGGGACACTGGGTAGTATTTGTTGATACGAGTACACATTCTTGCTGCCAATATTGTTCCCTTTGACAGTGGGTGTCCCTGTTGCCTCAACACTCCCCCTCGGAATGCAAGGCGGAGTCCGCCATACTGTTCGAGAGGAGAAAGTGCACAGAGACGTTCGAATTGAAGAAAGGGGATTGTGCCGGGACTTGGGTCCCGACCTTTTTTCTGTCCAAATTTGGGCATAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACACATTCGGATCTCTTCAG