ORFeome > lox ORF1 – XORFeome v1.0

lox ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lox
Gene ID: 491969
Gene Page ID: 491964
ORF Xenbase ID: 17282409

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130090
Original XGC clone length: 1287

Human orthology & disease relationships

NCBI Entrez ID: 4015
Ensembl gene IDs: ENSG00000113083
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 194050,219100,248500

Library Location

Plate ID: GDExl11085
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ837638
dbEST ID: 79655340
Trimmed Sequence: ATGGGCTGCGCCCCGGGGAGAGTCTTTTTATTGCAGCTCGTCCTGTATTTACATTGTCTTTTACTTGGGGACTGTCAGCAGCAAAGGAGCCCTGTGGGGCCGAGCTCCATGTGGAGACAGAGACTTCAGTGGCAGAGTAACGGGAGGGTGTACAGTCTGCTGAGCCACGGCTCCGAGTACCAGCCGGCCAGGCGCAGGGAGCAGGAGGGCAGCGCGCCCCACTCTCCGCTTCTTCTGCTCAGCAGCCGCCACAACAACAGCGTTTCCCAGGGCACCGGCGCACACAGAGCCCAACCTCCCAGATCCGTAACCCCAAGTGCGGAGGGGCAGCAGCAACAACCTGCGAGCACTAACCCGGCAGCACGGGAAGACGCCGCCGCCACCTCTCGCTTGTGGTTCCAGGCGACAAGGCAAAAAAACGCCGGAGATGCCGCCGGGAGACACAGGAGCGCAGGTGCCGCGCACGAGAGGCGTCAGGGCGCACAGGCGTCTCACACCCGAGTCAACGGGACAGACAGAATGGAGGGAATGCAGGGGGACGACCCGTATAACCCCTACCAATACTCCTAGGATAATCCCTATTACCACCAACATGAACCCAATTATAAAAACCAGGACGAATGAAAAGGCAGAGGCCCGGGCGAGGGTGACCCGGGTACTGTTCTAAAACGT
Full Trace Sequence: GGGGGGCCATATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCTGCGCCCCGGGGAGAGTCTTTTTATTGCAGCTCGTCCTGTATTTACATTGTCTTTTACTTGGGGACTGTCAGCAGCAAAGGAGCCCTGTGGGGCCGAGCTCCATGTGGAGACAGAGACTTCAGTGGCAGAGTAACGGGAGGGTGTACAGTCTGCTGAGCCACGGCTCCGAGTACCAGCCGGCCAGGCGCAGGGAGCAGGAGGGCAGCGCGCCCCACTCTCCGCTTCTTCTGCTCAGCAGCCGCCACAACAACAGCGTTTCCCAGGGCACCGGCGCACACAGAGCCCAACCTCCCAGATCCGTAACCCCAAGTGCGGAGGGGCAGCAGCAACAACCTGCGAGCACTAACCCGGCAGCACGGGAAGACGCCGCCGCCACCTCTCGCTTGTGGTTCCAGGCGACAAGGCAAAAAAACGCCGGAGATGCCGCCGGGAGACACAGGAGCGCAGGTGCCGCGCACGAGAGGCGTCAGGGCGCACAGGCGTCTCACACCCGAGTCAACGGGACAGACAGAATGGAGGGAATGCAGGGGGACGACCCGTATAACCCCTACCAATACTCCTAGGATAATCCCTATTACCACCAACATGAACCCAATTATAAAAACCAGGACGAATGAAAAGGCAGAGGCCCGGGCGAGGGTGACCCGGGTACTGTTCTAAAACGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCTGCGCCCCGGGGA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CGGGAGACGAGAGGCGCAGGCGCGAATCCTATAGCATATGTATCTACACATACACGAACGTGAGAGTGAGAGTGTGCAGGCGNGTGCGAAGGGAGAGAGAAAGAATTGATATTATATGTATTTNTGTACTGGCACGCGCATGAGCTCGCTCTCGCGCTCTGCCTACTCGGAGACAGAGAATATATACTATATGTTCTTNTGTCTGTCCTCTCTCGTCTTGCGCATAACGCATATCGGATCGAGAACATAGAGGACATCGCGTCGCCTATACATCTGTGTAGCACATATACACTCGCTTGCTATGGCCCGCATATAGACGACGCACGTGCATGTCGTGTGATGCCTTCTCTGTCGATGACCGCGTCGAAACCTATCCTCGCGTGCTGGACGGTGACATTAATCGATCTACTAGAAAGGAACGCACACACTGCGAGGCTAACGCCGACTGAGTCCGCGCGATACCGGGCAGCGTCACCGATCGNGAACGTAACGATACGCAGACGATGAGACGCGAGCGACATAGTAGCTATACAGCGATAGAGGACGAGAGACTGCGAGAGATCTACGTGCATGAACATGTAGTTAATCGCTGATTGTGTTGCATGGTGACGGCAGTGAATACAAGTGACACTCGTACCACGTGAACGTGCAGTCAGGCTGTCGCTAGATAGCACTCTTATCACTCGTCTTCTGCATCAACATCCTGTAAACTCAACTGTGTAGTAATACCTTATCACAATATACATGCGTATTCTGGTACTCAGTGTCGACACGCAAGCTCTGCCCCGAAGATCTCGTGATCGGTATACATCATACACAGCTTGCTGACGCAGAGCATACACAACTGCGCGGCGNGATCGCGCGCAGAATAGCTCACGAACCATACGCGATCTTAGGCANGAACCCTCGCTACCCATCCAGTCNCATGCAGCGTCCGTGCTCGTAGCCGCTGAGGAAAGTGACAGCGCCTAAANGCACACNACGAANCTCGATCAAGGAGTAGGCACTGGGGCGACGGACGCGCACAAGAGAATATGCANCCTCGCACACTCCGCTGTCCATTGGTCATGCGAGGCGACNCTGTNGTCACTGGCTAGGGTGATCTACGCGGCATCACAGGAAGACAAAACATATATACTAACACAAGAAGGGTATACACGTACGTACATAGTCGAGATGCGTACATAGGACAGATGACAATACCACCACCACACTAGCGAGACAAATAAGCCACATCTCCTATGCAAATACTGAGGAAATCAGAAACAGACGGCGAGAGCAGGAAGTCGAGCGCGAGCGCTCACCTGTGACTGTGGCATTAGTAAGAAGCGTGACACAGTTCTCGCATACTGGACCGAGTGCGTAGGCTCACTGGTGGCGATAATGGACGGGAGCACGGANGCGCTATATNTGTTGTGTGTGGAGAGCGAGGACCGTGTAGCAGAACTAGTACTATGGTGACACGCTTTAGTCTNAGTGTATACTATATCGGACAGATACGTCGGACNCTTGTGAGACGAGCGAACAGCTGCGTGATATGANA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAAGGAGAAATTGTGCAGCCGGA