ORFeome > loxl2 ORF1 – XORFeome v1.0

loxl2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: loxl2
Gene ID: 1010778
Gene Page ID: 1010774
ORF Xenbase ID: 17282421

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124862
Original XGC clone length: 2298

Human orthology & disease relationships

NCBI Entrez ID: 4017
Ensembl gene IDs: ENSG00000134013
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 123320,192600,207800,207900,215700,311250,601419,604765,606072,607801,608758

Library Location

Plate ID: GDExl11087
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ838162
dbEST ID: 79655864
Trimmed Sequence: ATGCTGGTGTCACATGTTTTCCTTCTAACCCTCTCCCTCTCTGTGCCTTCACTTGGGCAATATGAGCACTGGCCGTATTACCCAGAATATCAAGGGCCCCCAGAACCCCCACCAACTCTCCACTAGGTTGCGCACTATATCCAAGTAAGGTGGGAATATAACAAACCAATGCACAACGATGTGTTACAGCAAGCACGTAACTAACAGACAGAATACAAGCATTAGGTTGAACACCCGTGCAGAGATCACCCGGGGCACTATCGGTATTACAAGAGTGTTAGCCGCCTCCTGGCACCGCTAGCCCCTATCAAAGCATCACAGAAGACAAAGAACTGCCAACAAGATATCAATGCCAATAATGATCTCATCAATCAACTCAAAAGCACAGGTACCAACATCTCTCTGACACATAGCTGACACGACGGTGCCAACATCGAATTACTCCGAACACGAAAACACCTTGCGACTCAAATCTCTTGCGTGCATACTGAGGCACACAATGACCTCTATCTCCTCCAGGATTAGGAGAGAAAACCTCATGAACACAAGCAAAAGTTCAAGCCTAATTGTGCCCAACAACAGAAATCACTGGACTCCTCACCCCATCACACCAATGAACATAACCGTCAACGCGTCCACCTGCAATACACCCCCCTAAACCACAACTTTGATCTAAAAAAACATAAACCCCAACAAAGGGCTAAGAAGACTGCGAATAAAGACGAAAAGCCCCCCTCCCAGCACCCCAGAGGCAGGGAAA
Full Trace Sequence: CTCGAGGGCCAAATAATAGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGGTGTCACATGTTTTCCTTCTAACCCTCTCCCTCTCTGTGCCTTCACTTGGGCAATATGAGCACTGGCCGTATTACCCAGAATATCAAGGGCCCCCAGAACCCCCACCAACTCTCCACTAGGTTGCGCACTATATCCAAGTAAGGTGGGAATATAACAAACCAATGCACAACGATGTGTTACAGCAAGCACGTAACTAACAGACAGAATACAAGCATTAGGTTGAACACCCGTGCAGAGATCACCCGGGGCACTATCGGTATTACAAGAGTGTTAGCCGCCTCCTGGCACCGCTAGCCCCTATCAAAGCATCACAGAAGACAAAGAACTGCCAACAAGATATCAATGCCAATAATGATCTCATCAATCAACTCAAAAGCACAGGTACCAACATCTCTCTGACACATAGCTGACACGACGGTGCCAACATCGAATTACTCCGAACACGAAAACACCTTGCGACTCAAATCTCTTGCGTGCATACTGAGGCACACAATGACCTCTATCTCCTCCAGGATTAGGAGAGAAAACCTCATGAACACAAGCAAAAGTTCAAGCCTAATTGTGCCCAACAACAGAAATCACTGGACTCCTCACCCCATCACACCAATGAACATAACCGTCAACGCGTCCACCTGCAATACACCCCCCTAAACCACAACTTTGATCTAAAAAAACATAAACCCCAACAAAGGGCTAAGAAGACTGCGAATAAAGACGAAAAGCCCCCCTCCCAGCACCCCAGAGGCAGGGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGGTGTCACATGTTTTCCT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGGAATATGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCGAGTGGAGAGCTGGTTAGTGAGGAGCCCAGCTAAAATGTTCAAATTTCTCCTCGGTTTCTGTGCTGTACGATCCACCTATATGACAGTTGTACATCCAGATTCGTTGTCCGTCATACCGACAGCGGCACTTCATGATGTTATTAGTATAGTCGGACTCTGCCACCTCCTGGTTTGGATTAATGATAATCTGGAAAAAGTAATCGCCTGGCGCAACGTCTGTGATATCAACCCACTGACAGTCAATATCGTGTCTGAAAAGGTCCCAGCAGCCCACTATGATCCCTTGCACCCCAAAATTAACACAGACATACTGCTTCTGGATAACTGCTTCACACTCGGAATCCTCTAGGCAGAAGCTGGCCTTGTGTCCCTCTGCAACTTTGGTCCCGTTCAGACTCACCAGATCGTAATGGGTGAAAACTTCCATGCTGTGGTAATGGCGGTGACAGTCGTGCCATATCCAGGCCTGTCGGCCAGTCTTTGGGGCGGAAGTCAGCCTGAACATTGGTGTGAATCTGGAAAACTGAGCACAAGGAGCGGCGGTAACCGGTAATGGGACTGGTGCGATCAGCTGAAGAGGCGAGACCCTGCTTCTCCGTGGCACACTGGAGCATGAACATTGGCCCGGTCCTCTAAATATGTGGTTTAGCTCCGACCAGGGGCGGCTTTTAAGCGAAGGAATTTGGGGGCAAGTNCCGNCGCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCGAGTGGAGAGCTGGT