ORFeome > lpar4 ORF1 – XORFeome v1.0

lpar4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lpar4
Gene ID: 989378
Gene Page ID: 989372
ORF Xenbase ID: 17282445

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123269
Original XGC clone length: 1053

Human orthology & disease relationships

NCBI Entrez ID: 2846
Ensembl gene IDs: ENSG00000147145
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 112500,126600,142945,145260,147250,168500,214150,216400,278780,601675,604757,605462,607080,607778,608320

Library Location

Plate ID: GDExl11092
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ838759
dbEST ID: 79656461
Trimmed Sequence: ATGGGAAACGAAAGCAATAATTCCACCTGCCTCATTGATGACTCCTTTAAATATAATCTCTATGGGGCAGTTTACAGTGTGGTGTTCATCTTTGGGCTCATTACAAACTGTGCCTCCCTCTTTGTCTTCTGCTTTAAAATGAAGATGCAAAATGAAACTGCTATTTTCATGACTAACCTGGCAGTGTCTGATTTGCTCTTTGTATTTACACTGCCTTTTAAAATTTTTTATAATTTTAACCGGCACTGGCCCTTTGGTGACAGCTTGTGTAAGATTTCTGGGACAGCTTTCCTAACCAACATCTATGGAAGCATGCTTTTTCTCACGTGCATCAGCGTTGACCGATTCCTGGCCATCGTTTACCCATTTCGCTCCCGCACTATTCGAACCAGAAGAAATTCTGCTATAGTTTGTGCATGCGTGTGGATCATCGTGCTTAGCGGAGGTATTTCGGCATCCCTCTTTTCTACCACCAACGTTTCCNACACAAGTACCACGTGCTTTGAAGGTTTTTCAAAAAGCATCTGGAAAACATATTTGTCAAAAATCACCATATTTATTGAAGTAGTTGGATTTATCATCCCCTTGCTGTTAAACCTCACCTGCTCTTCTTTGGTCCTGAGGACTTTGAGAAAAACAACTACCCCTGTGCCGATTGGAAACAACAAAAAAAAAATTTTAAAAAATGAAACTACTTCACTTGGCCTATTTTTGTTTGTGTTGTTTTGGTAGCG
Full Trace Sequence: CTCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGNACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAAACGAAAGCAATAATTCCACCTGCCTCATTGATGACTCCTTTAAATATAATCTCTATGGGGCAGTTTACAGTGTGGTGTTCATCTTTGGGCTCATTACAAACTGTGCCTCCCTCTTTGTCTTCTGCTTTAAAATGAAGATGCAAAATGAAACTGCTATTTTCATGACTAACCTGGCAGTGTCTGATTTGCTCTTTGTATTTACACTGCCTTTTAAAATTTTTTATAATTTTAACCGGCACTGGCCCTTTGGTGACAGCTTGTGTAAGATTTCTGGGACAGCTTTCCTAACCAACATCTATGGAAGCATGCTTTTTCTCACGTGCATCAGCGTTGACCGATTCCTGGCCATCGTTTACCCATTTCGCTCCCGCACTATTCGAACCAGAAGAAATTCTGCTATAGTTTGTGCATGCGTGTGGATCATCGTGCTTAGCGGAGGTATTTCGGCATCCCTCTTTTCTACCACCAACGTTTCCNACACAAGTACCACGTGCTTTGAAGGTTTTTCAAAAAGCATCTGGAAAACATATTTGTCAAAAATCACCATATTTATTGAAGTAGTTGGATTTATCATCCCCTTGCTGTTAAACCTCACCTGCTCTTCTTTGGTCCTGAGGACTTTGAGAAAAACAACTACCCCTGTGCCGATTGGAAACAACAAAAAAAAAATTTTAAAAAATGAAACTACTTCACTTGGCCTATTTTTGTTTGTGTTGTTTTGGTAGCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAACGAAAGCAATAATTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838758
dbEST ID: 79656460
Trimmed Sequence: GTCCTTGTAATTAGCTTCAGACATTAATTCTCCTCCATTATTAATGTTCATCTGTTCAGTCAGCTCCTCTTGTGTAACTGGCAAGGCTATTTTCGTAGCACAATCAATCTTAAATAGGGTATCCATTTTAATGATAGGGTTGATGTTAAATGACTTCTGAAAGGATTTTGAAGTGAAGTAGTAAACAAATGGATCAAAGCACCAGTTCATCGTTGCAATGCAAAAAGTGATTGGATACATTGTCCATGCAAATCTCTCCACGGGACAATTGGAAATGGCTTGGGAGCGGACCAAAACATACACGAAGACGATAAAATTAAAGGGTACAAAACACACAACATAAATAGCCAAGTGAACGACAATCAATTTCAGAACATTCTCTTTGCTGGTTCCGATCTGGCACACGGAAGCAGGTTTTCTCAAAGTCCCGCGAGAACAAATAACAGGAAGTTGAACTGTAAGACAAGGGGGGAAAATAAATCCCACTAGGTTACTACAAAACGGTGAAATTTTGAAAAATAAGTGGGTGCCAAGACTCTTCAAAAAACAAAAGAACAAGCGGCGAAGGTTTAGGTGGAAAATTTTTGCTTCGAAAAGAAACTGAAAATGTCAAAATCCCTCAGAGAAACCGATGATGATAGAAAAGAGGTCTCCCAGGGGGCCGGAAACAAAAAGGTTAGAGTCGGGAATTAACAACATGGAAAGAAGAAGCCGTAACAA
Full Trace Sequence: AGACGGCGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCCTTGTAATTAGCTTCAGACATTAATTCTCCTCCATTATTAATGTTCATCTGTTCAGTCAGCTCCTCTTGTGTAACTGGCAAGGCTATTTTCGTAGCACAATCAATCTTAAATAGGGTATCCATTTTAATGATAGGGTTGATGTTAAATGACTTCTGAAAGGATTTTGAAGTGAAGTAGTAAACAAATGGATCAAAGCACCAGTTCATCGTTGCAATGCAAAAAGTGATTGGATACATTGTCCATGCAAATCTCTCCACGGGACAATTGGAAATGGCTTGGGAGCGGACCAAAACATACACGAAGACGATAAAATTAAAGGGTACAAAACACACAACATAAATAGCCAAGTGAACGACAATCAATTTCAGAACATTCTCTTTGCTGGTTCCGATCTGGCACACGGAAGCAGGTTTTCTCAAAGTCCCGCGAGAACAAATAACAGGAAGTTGAACTGTAAGACAAGGGGGGAAAATAAATCCCACTAGGTTACTACAAAACGGTGAAATTTTGAAAAATAAGTGGGTGCCAAGACTCTTCAAAAAACAAAAGAACAAGCGGCGAAGGTTTAGGTGGAAAATTTTTGCTTCGAAAAGAAACTGAAAATGTCAAAATCCCTCAGAGAAACCGATGATGATAGAAAAGAGGTCTCCCAGGGGGCCGGAAACAAAAAGGTTAGAGTCGGGAATTAACAACATGGAAAGAAGAAGCCGTAACAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCTTGTAATTAGCTTCAGACAT