ORFeome > lrrc47 ORF2 – XORFeome v1.0

lrrc47 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lrrc47
Gene ID: 967815
Gene Page ID: 967811
ORF Xenbase ID: 17282559

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124923
Original XGC clone length: 1701

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ837455
dbEST ID: 79655157
Trimmed Sequence: ATGGCTTCAGTCGGGGCGGCAGGGTGGCCTGAGTTAGAGAAGGTAGAACGTGAGAAGCGACGGGAGCTGGTCCTGCAGGGTTTGGATGAGAAGCTCCGCGTTTGTGCCGGGCAGCTGCCCCCTCAGCTCTTTTCCCTCACTCTTCTCAACTATCTGGAAGTGAGCGGCTGTTCGGAGCTGAGAGAGATTCCTCCCGGCCTGGGCCACCTCATACACCTGCAGAACCTGGTCCTGTGCCGCAACAAGCTGCGCCTCCTATCTCCGGCTGTCGGACAGCTGCGGGCCCTGCGCTTGTTGGACGTCTCCGGAAACGAGTTAGAAGAGTTGCCGGCGGAGCTATGCGGCCTGCCCGAGCTCTGCACCTTAAATGTCAGCTGCAACCAACTGATGGAGCTTCCCCCGGGGCTGGAGCGCTGCTCCAAACTGGCCGAGCTCAACCTCTCCCGGAATCGTGTCCGAGCTCTCCCTCCCGGGCTCCTGTGCCGACAGCTGTCTCTACTCGCCTCTCTCTCTGCTGCCGACAATCAGATCCACCAGCTGCCGGGGGACATTGGCCTCCTGCCTGCCCTCAAGAGCCTTGATCTCTCCCATAACCTGCTCACTGACATCGGATTTGGAGCTTGCGGACTGCTCCAGAGCTGAGGGATTTAAATTTCAAAAGCCAACAGGGGGGAGGGATGAGAGGCCCGGCGAAAAGAGGGGCAAATGGGGTCCCCGAGGGGAATCGTGGGGCTTGGGTTCGCTGAAAAATTTGTGGGCCCAAGGGGGAGGGGGGGGAGGGGGGGGGGGGGTGAGCGTCACAAATTCCAACACAAAAAGAAATAGGGAA
Full Trace Sequence: CGTGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTCAGTCGGGGCGGCAGGGTGGCCTGAGTTAGAGAAGGTAGAACGTGAGAAGCGACGGGAGCTGGTCCTGCAGGGTTTGGATGAGAAGCTCCGCGTTTGTGCCGGGCAGCTGCCCCCTCAGCTCTTTTCCCTCACTCTTCTCAACTATCTGGAAGTGAGCGGCTGTTCGGAGCTGAGAGAGATTCCTCCCGGCCTGGGCCACCTCATACACCTGCAGAACCTGGTCCTGTGCCGCAACAAGCTGCGCCTCCTATCTCCGGCTGTCGGACAGCTGCGGGCCCTGCGCTTGTTGGACGTCTCCGGAAACGAGTTAGAAGAGTTGCCGGCGGAGCTATGCGGCCTGCCCGAGCTCTGCACCTTAAATGTCAGCTGCAACCAACTGATGGAGCTTCCCCCGGGGCTGGAGCGCTGCTCCAAACTGGCCGAGCTCAACCTCTCCCGGAATCGTGTCCGAGCTCTCCCTCCCGGGCTCCTGTGCCGACAGCTGTCTCTACTCGCCTCTCTCTCTGCTGCCGACAATCAGATCCACCAGCTGCCGGGGGACATTGGCCTCCTGCCTGCCCTCAAGAGCCTTGATCTCTCCCATAACCTGCTCACTGACATCGGATTTGGAGCTTGCGGACTGCTCCAGAGCTGAGGGATTTAAATTTCAAAAGCCAACAGGGGGGAGGGATGAGAGGCCCGGCGAAAAGAGGGGCAAATGGGGTCCCCGAGGGGAATCGTGGGGCTTGGGTTCGCTGAAAAATTTGTGGGCCCAAGGGGGAGGGGGGGGAGGGGGGGGGGGGGTGAGCGTCACAAATTCCAACACAAAAAGAAATAGGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTCAGTCGGGGCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837454
dbEST ID: 79655156
Trimmed Sequence: GCGCATGATAGCGAAGGCAGAAGAACTGAAGTTCAGGTCTGTTTTGGAAGGATACAAAACCTTAAGGTTTCCTTCAATATCAGAGACACGCACTTGTTCCAGTACGAGCTGAGCGGCCGTCCCTGCGTTGGGATTATTACTGGCCAATGGCTCTTGCTGATCCTCTGCTTCAGGCTCAGTGTCTGAAACACCTTCTGGCTCTTTGTTTTCCAATGTAAACTTATGGAGCTCTGCCATTTTAAGGATGAGTGCGTCTAAGACATCTTTGCAGATCTGCAGGCTGGTGCCACTTGTTACTTCCACAAAGACTTCTTGGGTGCTTTTCCAGATCTTTGTCTTCTCGCTGTTTGTGATTGGTGGGAAGGAAATGACTGCATTCTCAGTATCAATTAAACAGGGATAATTTTCTTTGCGATCCAATAAATGAAGGTACTTGTGAAGTCCAGAGACATTCTGTCGCTTTTTCTGCTTCCTTTGCTCCTCTGCCTCAGACTGCAGTTGCCGAACAAGATCCTTCGCATTGATCTCTTTGCGACCCACAGGTATAACCGTTAGGTCTTTGAGTGGTCGGGCGGCGGACGATACAGGTCCTTTTCCTAAGCGCAAATCGTGGAGGGGGGGGGGTGGCGAAAGTCCTTCTATCGCCTATTTCCTCGTGGGAGCCTGGGGCCGGGCCGGGGGGGGAGCCCTTTTCCTAACATTTTGCCTGGGGGTGGGGGGGGGGGGGTGGGTGTGCCCCCTTCCCTCCCCCGCGGGGGGGTGGGGGGGGCGGGGTTGGGGGGTG
Full Trace Sequence: AAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGCATGATAGCGAAGGCAGAAGAACTGAAGTTCAGGTCTGTTTTGGAAGGATACAAAACCTTAAGGTTTCCTTCAATATCAGAGACACGCACTTGTTCCAGTACGAGCTGAGCGGCCGTCCCTGCGTTGGGATTATTACTGGCCAATGGCTCTTGCTGATCCTCTGCTTCAGGCTCAGTGTCTGAAACACCTTCTGGCTCTTTGTTTTCCAATGTAAACTTATGGAGCTCTGCCATTTTAAGGATGAGTGCGTCTAAGACATCTTTGCAGATCTGCAGGCTGGTGCCACTTGTTACTTCCACAAAGACTTCTTGGGTGCTTTTCCAGATCTTTGTCTTCTCGCTGTTTGTGATTGGTGGGAAGGAAATGACTGCATTCTCAGTATCAATTAAACAGGGATAATTTTCTTTGCGATCCAATAAATGAAGGTACTTGTGAAGTCCAGAGACATTCTGTCGCTTTTTCTGCTTCCTTTGCTCCTCTGCCTCAGACTGCAGTTGCCGAACAAGATCCTTCGCATTGATCTCTTTGCGACCCACAGGTATAACCGTTAGGTCTTTGAGTGGTCGGGCGGCGGACGATACAGGTCCTTTTCCTAAGCGCAAATCGTGGAGGGGGGGGGGTGGCGAAAGTCCTTCTATCGCCTATTTCCTCGTGGGAGCCTGGGGCCGGGCCGGGGGGGGAGCCCTTTTCCTAACATTTTGCCTGGGGGTGGGGGGGGGGGGGTGGGTGTGCCCCCTTCCCTCCCCCGCGGGGGGGTGGGGGGGGCGGGGTTGGGGGGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGCATGATAGCGAAGGCAGA