ORFeome > lrrc58 ORF1 – XORFeome v1.0

lrrc58 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lrrc58
Gene ID: 963291
Gene Page ID: 963288
ORF Xenbase ID: 17282571

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108489
Original XGC clone length: 1053

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ837953
dbEST ID: 79655655
Trimmed Sequence: ATGGAGGGCCCCGAGGTAACCGATGGGGACAATGTTCTGAATCTGACCCACTTGGGTCTTGAGAACCTTAACTTGGAGCTGGTGAGTGAGAACAAGAGGAAGGATGTCCAACAGATACTTCTGCCCCACAACCGCCTGGTGGTCTTACCCCCCCTGGTGGCCTCCTTCATCCACCTGCACCTCCTGGACATTAGCAACAACAACATGGTCTACATTGGAGAGGAGATCCTGGGGCTGACTAAGCTGAAGACCCTGCTGGCCAAAAACAACCGTCTGGATGAGTTCTCCTTCCCCAAAGAGATGGGGGGCATGAGACTGGAGGTGCTCAACCTGAGTGGAAACCGCTTTGAGGAGATACCGGACCAGTTTCTTCAGATCCCCACCTTAAAGAGCCTGTCACTGGGGGGGAACCGCCTGAAGAGCATCCCGGCCGAGATCGAGAACCTGATCAGCCTGGAATTCCTGTACCTGGGCGGAAACTTCATCAGCTCCCTCCCCTCACAACTGGCCAACCTGCCGTATCTCAGCTACTTGGTTCTGTGTGACAACCGGATCCAGAGCATCCCCCCTCAGTTGGCCCAGGTTCACTCCCTGCGCCTCCTCCATTTTGCCAACAACCTCCTGACTTACCTGCCCCGTGAGAATCTCAACCTGGTGGCACCTGCCCAACTGAGCCTTTCCTGGGAAACCCGCGGGTGGTGCGCTTTTTTGCGAAACCTTTACTTACACCCCTTCCCACATTTATGGAAACTAACCCCGAAGCCCCCCATCCAAAAAATCCATGGGACATTTCTTTATCCTGCCCCCTGGGAAACCTCGGG
Full Trace Sequence: TCGCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGGCCCCGAGGTAACCGATGGGGACAATGTTCTGAATCTGACCCACTTGGGTCTTGAGAACCTTAACTTGGAGCTGGTGAGTGAGAACAAGAGGAAGGATGTCCAACAGATACTTCTGCCCCACAACCGCCTGGTGGTCTTACCCCCCCTGGTGGCCTCCTTCATCCACCTGCACCTCCTGGACATTAGCAACAACAACATGGTCTACATTGGAGAGGAGATCCTGGGGCTGACTAAGCTGAAGACCCTGCTGGCCAAAAACAACCGTCTGGATGAGTTCTCCTTCCCCAAAGAGATGGGGGGCATGAGACTGGAGGTGCTCAACCTGAGTGGAAACCGCTTTGAGGAGATACCGGACCAGTTTCTTCAGATCCCCACCTTAAAGAGCCTGTCACTGGGGGGGAACCGCCTGAAGAGCATCCCGGCCGAGATCGAGAACCTGATCAGCCTGGAATTCCTGTACCTGGGCGGAAACTTCATCAGCTCCCTCCCCTCACAACTGGCCAACCTGCCGTATCTCAGCTACTTGGTTCTGTGTGACAACCGGATCCAGAGCATCCCCCCTCAGTTGGCCCAGGTTCACTCCCTGCGCCTCCTCCATTTTGCCAACAACCTCCTGACTTACCTGCCCCGTGAGAATCTCAACCTGGTGGCACCTGCCCAACTGAGCCTTTCCTGGGAAACCCGCGGGTGGTGCGCTTTTTTGCGAAACCTTTACTTACACCCCTTCCCACATTTATGGAAACTAACCCCGAAGCCCCCCATCCAAAAAATCCATGGGACATTTCTTTATCCTGCCCCCTGGGAAACCTCGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGGCCCCGAGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837952
dbEST ID: 79655654
Trimmed Sequence: TCCCAGAAGCACCTTCTGCATTCTGCGGGCAGCCACATTAACCTCATCCTCGGAGTCGGACTCGCTGTGGGAGGTGGAGCCACAGGGGGAGGAGCACTCTGGAGAGCACAGGTAGTGCATGAGAGGCAGGCGGTACTTCCCACAGAAATCCACAAACTTGATCTGCCGCACACAGCAATCAAAATATACACCACTACACTTGGGGTTGGGGCACTTGCTGGCCAGGTCCAGGTACCTCAGCAGGTTTTCCGGCAGCTCCCAGGGGCAGTAAGGAATGCCATGACTCTTGATGGTGCGTCCGGCTAGTTCCAATAATGTGGGAGGGGTGTAGGTAAGGTCTCGCACAAAGCGCACCACCAGGGGGTTCCCACGCAAGCTCAGTTCGTGCAGGTGCACCAGGCTGAGAATCTCACGGGGCAGGTAAGTCAGGAGGTTGTTGTGCAAACTGAGGGAGCCCAGGGAGTGAACCTGGGCGCGCTGAGGGGGGATGCTCTGGATCCGGTTTTCACACGGAACCAGATACCTGAAATTACGGCAGGTTGGCCGGCTCCAAAGGGATGGAAGCGAAGAAATTTCCTTCCACCTACAAAAATTCAAGGGAGGACAAGGATCTCGATCGTGGGCCGGGAGGGACGTTCGGGCGGTTCCCGGGGCATCACCGGCGGTTTGGAGGTGGGAAAGTAAAAAAAAACGTGATCCGAAATTCCCCGCCCAGGGCGGATTTCCCAACCCAAAACTGAAGCCACCCTGGCCAC
Full Trace Sequence: AAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCCAGAAGCACCTTCTGCATTCTGCGGGCAGCCACATTAACCTCATCCTCGGAGTCGGACTCGCTGTGGGAGGTGGAGCCACAGGGGGAGGAGCACTCTGGAGAGCACAGGTAGTGCATGAGAGGCAGGCGGTACTTCCCACAGAAATCCACAAACTTGATCTGCCGCACACAGCAATCAAAATATACACCACTACACTTGGGGTTGGGGCACTTGCTGGCCAGGTCCAGGTACCTCAGCAGGTTTTCCGGCAGCTCCCAGGGGCAGTAAGGAATGCCATGACTCTTGATGGTGCGTCCGGCTAGTTCCAATAATGTGGGAGGGGTGTAGGTAAGGTCTCGCACAAAGCGCACCACCAGGGGGTTCCCACGCAAGCTCAGTTCGTGCAGGTGCACCAGGCTGAGAATCTCACGGGGCAGGTAAGTCAGGAGGTTGTTGTGCAAACTGAGGGAGCCCAGGGAGTGAACCTGGGCGCGCTGAGGGGGGATGCTCTGGATCCGGTTTTCACACGGAACCAGATACCTGAAATTACGGCAGGTTGGCCGGCTCCAAAGGGATGGAAGCGAAGAAATTTCCTTCCACCTACAAAAATTCAAGGGAGGACAAGGATCTCGATCGTGGGCCGGGAGGGACGTTCGGGCGGTTCCCGGGGCATCACCGGCGGTTTGGAGGTGGGAAAGTAAAAAAAAACGTGATCCGAAATTCCCCGCCCAGGGCGGATTTCCCAACCCAAAACTGAAGCCACCCTGGCCAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCCAGAAGCACCTTCTGCAT