ORFeome > lsm1 ORF1 – XORFeome v1.0

lsm1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lsm1
Gene ID: 971228
Gene Page ID: 971222
ORF Xenbase ID: 17282655

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141743
Original XGC clone length: 402

Human orthology & disease relationships

NCBI Entrez ID: 27257
Ensembl gene IDs: ENSG00000175324
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 126600,145260,216400,263800,278780,601414,608320

Library Location

Plate ID: GDExl11091
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ838859
dbEST ID: 79656561
Trimmed Sequence: ATGAATTATATGCCCGGGACCGCCAGCCTCATAGAGGATATAGACAAAAAACACTTGGTCTTACTGAGAGATGGGAGGACCCTTATAGGATATCTAAGGAGCATTGACCAATTTGCAAATCTTGTGTTGCATCAGACCGTGGAGAGAATCCATGTCGGCAAGAAATATGGTGACATACCACGAGGAATTTTTGTTGTGCGGGGGGAGAACGTGGTCCTGCTGGGCGAGATTGACCTGGAGAAAGAAAGCGACACCCCTCTCCATCAGGTCTCCATAGAGGAAATCCTAGAGGATCAGCGCATCGAGCAGCAGAGCAAGAACGAAGCGGAGAAGCTGAAGGTGCAGGCTCTAAAAGAGCGGGGCCTGTCCATCCCCAGAGCAGACACTCTGGATGAATACTT
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATTATATGCCCGGGACCGCCAGCCTCATAGAGGATATAGACAAAAAACACTTGGTCTTACTGAGAGATGGGAGGACCCTTATAGGATATCTAAGGAGCATTGACCAATTTGCAAATCTTGTGTTGCATCAGACCGTGGAGAGAATCCATGTCGGCAAGAAATATGGTGACATACCACGAGGAATTTTTGTTGTGCGGGGGGAGAACGTGGTCCTGCTGGGCGAGATTGACCTGGAGAAAGAAAGCGACACCCCTCTCCATCAGGTCTCCATAGAGGAAATCCTAGAGGATCAGCGCATCGAGCAGCAGAGCAAGAACGAAGCGGAGAAGCTGAAGGTGCAGGCTCTAAAAGAGCGGGGCCTGTCCATCCCCAGAGCAGACACTCTGGATGAATACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAAATAAAGACCGTGTCTCAAAATCTCTGATGTTACAAAANCNNNNNNNNNGNNNGNNTNNNNNNNGTNNGNTNNNNGGNNTTGGGTTNNGCCCAAAAAAAAAAAATAAAAAAGTAATACATTATGAATGATATAAAGGAATGAGAAAAGAAAGAGGGGNNGTGNGGGTGCGTGGCTGGGTGGTGGGGACTTAACGTTGTAAGTGTNGNTGAAGGGAAGTGAATATGGATGAGANTTATTTGTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTATATGCCCGGGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838858
dbEST ID: 79656560
Trimmed Sequence: GTATTCATCCAGAGTGTCTGCTCTGGGGATGGACAGGCCCCGCTCTTTTAGAGCCTGCACCTTCAGCTTCTCCGCTTCGTTCTTGCTCTGCTGCTCGATGCGCTGATCCTCTAGGATTTCCTCTATGGAGACCTGATGGAGAGGGGTGTCGCTTTCTTTCTCCAGGTCAATCTCGCCCAGCAGGACCACGTTCTCCCCCCGCACAACAAAAATTCCTCGTGGTATGTCACCATATTTCTTGCCGACATGGATTCTCTCCACGGTCTGATGCAACACAAGATTTGCAAATTGGTCAATGCTCCTTAGATATCCTATAAGGGTCCTCCCATCTCTCAATAAGACCAAGTGTTTTTTGTCTATATCCTCTATGAGGCTGGCGGTCCCGGGCATATAATTCATGG
Full Trace Sequence: GGCACACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTATTCATCCAGAGTGTCTGCTCTGGGGATGGACAGGCCCCGCTCTTTTAGAGCCTGCACCTTCAGCTTCTCCGCTTCGTTCTTGCTCTGCTGCTCGATGCGCTGATCCTCTAGGATTTCCTCTATGGAGACCTGATGGAGAGGGGTGTCGCTTTCTTTCTCCAGGTCAATCTCGCCCAGCAGGACCACGTTCTCCCCCCGCACAACAAAAATTCCTCGTGGTATGTCACCATATTTCTTGCCGACATGGATTCTCTCCACGGTCTGATGCAACACAAGATTTGCAAATTGGTCAATGCTCCTTAGATATCCTATAAGGGTCCTCCCATCTCTCAATAAGACCAAGTGTTTTTTGTCTATATCCTCTATGAGGCTGGCGGTCCCGGGCATATAATTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCATTATTTTGGGGCCAAAAAAAAAAACAGGCCATCGTTTTACACGCCGAAAGACTAGGGNNNNNNNNNNNNNNNNNNNNNNNNNGGNNNNNGNNNNAAAAAGAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAAANNNNNNNNAAANAAAAAANNNAANNNNNNNNNGGAGAGGGGNNNNGAAGGGNNNNNNNNGNNNNNNNNNNNNNNNNNNGNNNNNNNGAGANNNNNNNNGNGGNNNNNNNNNGGGNNGNNNGNNNNNNNNNNNNNNGNNNNANNNGNNGANN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTATTCATCCAGAGTGTCTGCT