ORFeome > lsm6 ORF2 – XORFeome v1.0

lsm6 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lsm6
Gene ID: 1007013
Gene Page ID: 1007007
ORF Xenbase ID: 17282715

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128975
Original XGC clone length: 243

Human orthology & disease relationships

NCBI Entrez ID: 11157
Ensembl gene IDs: ENSG00000164167
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 601414

Library Location

Plate ID: GDExl11090
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ838555
dbEST ID: 79656257
Trimmed Sequence: ATGAGCCTGCGCAAACAAACACCAAGTGACTTCTTAAAGCAGATTATCGGAAGACCAGTGGTGGTAAAGCTCAACTCTGGAGTTGATTATCGAGGTGTTCTGGCATGCTTAGATGGCTACATGAATATTGCTTTGGAACAAACTGAAGAATATGTGAATGGACAGCTGAAGAACAAATATGGGGATGCATTTATCCGAGGAAATAATGTTTTGTATATAAGCACTCAGAAGAGGAGGATGTT
Full Trace Sequence: GCTCGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCCTGCGCAAACAAACACCAAGTGACTTCTTAAAGCAGATTATCGGAAGACCAGTGGTGGTAAAGCTCAACTCTGGAGTTGATTATCGAGGTGTTCTGGCATGCTTAGATGGCTACATGAATATTGCTTTGGAACAAACTGAAGAATATGTGAATGGACAGCTGAAGAACAAATATGGGGATGCATTTATCCGAGGAAATAATGTTTTGTATATAAGCACTCAGAAGAGGAGGATGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGAACAGAAAAAAAGAATAACAAATATTACAGAGTCCGCCCTGCAAAAAAAGCAAAAAAAAAAAGATTCCTCGGCACACCGGGGTGCCCGGGGATCCTGGACGTTGAAAGGGAAGACTCCCCTACCAAAAGAAGATTACCGGGTGGGTTCTTAACTGTGAAAGAGAGTAACAGAGCGCCGTCCCCCACTGGGCCAAACCTTGTGGTGAGGTTGGGTGGGGTGAGGGCAATGGGGGTTGTATTGGTCTTTTATTATTTTTTTTCTAAACGTGTTTGCAGCACGCTTGTCGGGGCAAAGACGTCCTACTCGTCGGGTTTATTGGTGGGTGTATTGTTATAGATATATTTTTGTAGTGGATAGATTTCCTAGGAAGGGTAGTGGNGGNGTGGTCGGGATGGGTTTANGGGTGCGATCNCTCGTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCCTGCGCAAACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838554
dbEST ID: 79656256
Trimmed Sequence: GCAACATCCTCCTCTTCTGAGTGCTTATATACAAAACATTATTTCCTCGGATAAATGCATCCCCATATTTGTTCTTCAGCTGTCCATTCACATATTCTTCAGTTTGTTCCAAAGCAATATTCATGTAGCCATCTAAGCATGCCAGAACACCTCGATAATCAACTCCAGAGTTGAGCTTTACCACCACTGGTCTTCCGATAATCTGCTTTAAGAAGTCACTTGGTGTTTGTTTGCGCAGGCTCATGG
Full Trace Sequence: AGCGAGTGGTAATNACGACTCACTATNAGGGGATATCAGCTGGGATGGAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGGCAACATCCTCCTCTTCTGAGTGCTTATATACAAAACATTATTTCCTCGGATAAATGCATCCCCATATTTGTTCTTCAGCTGTCCATTCACATATTCTTCAGTTTGTTCCAAAGCAATATTCATGTAGCCATCTAAGCATGCCAGAACACCTCGATAATCAACTCCAGAGTTGAGCTTTACCACCACTGGTCTTCCGATAATCTGCTTTAAGAAGTCACTTGGTGTTTGTTTGCGCAGGCTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGAAAAACAATTTACAACGCAATGACTGGGTGGTACGGCATGGCAGGAAGAAATAAAGGAAAGACGTAACTGAAAAATGGGGTGTCGGGTGATCTGATCGTGGAAAGGGAAGACGCCCGAAACAAAAGGAATAATCCTGGTCGGATCTAAGATGTAATGGAGTAGCCTAGCGGTACACCACGGGGTCAAAAACTTGGGCGAAACGAACGGGGGGACGGGACAAAGCCGGGTTTTAGGGTGTGTTTATAATTTTATAATTGGGTAGAACCANACACCACGCCCAGTCACCAAACAGACACGAATCAACCGGGGGTATAAGGTTTGTAAGAGATGAGCGAAAACNGNGAGACCAAAGACNGNAACAAGGNAGAGCGGGGGAAAGGGGAAAACNGNNGGGAGAANAGANNNAANNNNCGGGGAGGGANNGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATCCTCCTCTTCTGAGT