ORFeome > lsp1 ORF1 – XORFeome v1.0

lsp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lsp1
Gene ID: 866008
Gene Page ID: 490854
ORF Xenbase ID: 17282739

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC124867
Original XGC clone length: 1314

Human orthology & disease relationships

NCBI Entrez ID: 4046
Ensembl gene IDs: ENSG00000130592
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 268000,300291,300301,300584,308300

Library Location

Plate ID: GDExl11088
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ838154
dbEST ID: 79655856
Trimmed Sequence: ATGTCCGACAATGAAGAGGTTCTGAGAGAGGAGGGGTGCGAGGAGCAGACCCTTGAGGAGAGGCTGGAAGAAACCCAAAGACTAACCACCCAGTGGAGTGTGGAGGATGAGGAGGAGGCAGCCCGAGAGCGTCGCAGGAGAGAACGTGAAAGACAACAACAGGATGAGAGTGAAGATGGAGACACAGGAGAGAACATGACAGGGGGAACCTGCACCCAGAGTGATGACCATGTGGTGTTAAAGCCTGGGCGACCCATGGAATGTGAGGAAGATGAAGGATTCAGTGACTGGTCCCAAAGGCAAGTGCAGATGAAACTGCAGGGTGCAATCCAGGCCACCGAGGAAGCGGGTGAAGCAAGAGCAGCTGAAGAGGAGGGAAGTGTCTCCCCAAAAGTTAGAGAAGAAGAGAGCGAGGAAGCACCAATATCAAGGGAGGAGGAAGAGGAGGATGAAGGCACATCCCGTTATGAAGCAACAGAGTTGAGTGACGACCCCTGCAACTGTGACCCCGAGCCCTGCGAGCAAGATGAGCAGACTCTCTCCACCCACCACTGGGCAACAGGTATTTCAGAATCACATGCAGATGATGAGAATTTGGATTATGAACCTAAGAGCCATGAGGTACCAGAAGAAACCAATGAAAAATTTGGAAGAAACTGGCTATTATTCCTCTAGACCCCAGGCTCAGGACCGATCCGAAGACACCAAAGGAAAAGGTGGGGGGGGGGAGGTGGGAAACCAAATTTAACCCTTCCGTTAAACAGGTGATTGAAAAGAGGGGAGGGGAGCGAGGGCAGCAACCGGGTCCACAATA
Full Trace Sequence: GACCCCAAATAATAGATTTTATTTTNGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCGACAATGAAGAGGTTCTGAGAGAGGAGGGGTGCGAGGAGCAGACCCTTGAGGAGAGGCTGGAAGAAACCCAAAGACTAACCACCCAGTGGAGTGTGGAGGATGAGGAGGAGGCAGCCCGAGAGCGTCGCAGGAGAGAACGTGAAAGACAACAACAGGATGAGAGTGAAGATGGAGACACAGGAGAGAACATGACAGGGGGAACCTGCACCCAGAGTGATGACCATGTGGTGTTAAAGCCTGGGCGACCCATGGAATGTGAGGAAGATGAAGGATTCAGTGACTGGTCCCAAAGGCAAGTGCAGATGAAACTGCAGGGTGCAATCCAGGCCACCGAGGAAGCGGGTGAAGCAAGAGCAGCTGAAGAGGAGGGAAGTGTCTCCCCAAAAGTTAGAGAAGAAGAGAGCGAGGAAGCACCAATATCAAGGGAGGAGGAAGAGGAGGATGAAGGCACATCCCGTTATGAAGCAACAGAGTTGAGTGACGACCCCTGCAACTGTGACCCCGAGCCCTGCGAGCAAGATGAGCAGACTCTCTCCACCCACCACTGGGCAACAGGTATTTCAGAATCACATGCAGATGATGAGAATTTGGATTATGAACCTAAGAGCCATGAGGTACCAGAAGAAACCAATGAAAAATTTGGAAGAAACTGGCTATTATTCCTCTAGACCCCAGGCTCAGGACCGATCCGAAGACACCAAAGGAAAAGGTGGGGGGGGGGAGGTGGGAAACCAAATTTAACCCTTCCGTTAAACAGGTGATTGAAAAGAGGGGAGGGGAGCGAGGGCAGCAACCGGGTCCACAATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGACAATGAAGAGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838153
dbEST ID: 79655855
Trimmed Sequence: AGGATCTTCCATGTAAACCTTCTCGTATTTCCCATGTCCAGTTGGAACAAACTTGTATTTCTTACTAGCGCTCAGACTCTTCCCACTTTGCTCCGATGTGGTACTCTGCTCCCATAGATTTTTCTTACTCAGAACATCCCCAGGTCTCACCTCCGTTGGCTTACAAGGTGACTGAGCCGTGTCTGCATCTGATTTCCCTTTGCCCCACTGACTAATCATTTCTGACACACCAATGGCGATTCCTTCTGTATCCTTGCAGGGCGATGCTTTGGCTGCTGTGGTCACATCTCCAGCTTCCCAGCGATTCTTCTTGACTGAAACTGCATCTACGGGGGTCAAAAGTTCTAAAGATGGTGTCCGAGTCAATTTGGGCTGCTTACTGGAGGTCTCTATGGCGTGCGTGTATTGCTCCAGGCGGTCGTCGATCTTGCTTATTGGAAGAGGGGGTTCGCTCTTCTTTATGCTGTTGCTCTTCTGGATGGAAAGGTTCAAGCACTCTGTCCTTTCAGTTATCTTTACAGTTGTTGCAATGGTTCCTTCACTCTCTCCATCACTGCTCACTGAGAGCCTACGAACGGCTTCCACTTCTGCCTCCCACCTCCTCCTGGGTGTCTCTGATTGGTCCTGACCCTCTGGTCTAGAGAAAAAATAACCAAGTTTCTCCCCCATTTTCTTTGGTCCTCTTCGGGTACCCTCATGGCTTTTTAAGCTCATAACTCCCAAATTCTCCATCCAACTGACAATGTAAATTTTTAAAAAAAACCTTTGTTT
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATANGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGATCTTCCATGTAAACCTTCTCGTATTTCCCATGTCCAGTTGGAACAAACTTGTATTTCTTACTAGCGCTCAGACTCTTCCCACTTTGCTCCGATGTGGTACTCTGCTCCCATAGATTTTTCTTACTCAGAACATCCCCAGGTCTCACCTCCGTTGGCTTACAAGGTGACTGAGCCGTGTCTGCATCTGATTTCCCTTTGCCCCACTGACTAATCATTTCTGACACACCAATGGCGATTCCTTCTGTATCCTTGCAGGGCGATGCTTTGGCTGCTGTGGTCACATCTCCAGCTTCCCAGCGATTCTTCTTGACTGAAACTGCATCTACGGGGGTCAAAAGTTCTAAAGATGGTGTCCGAGTCAATTTGGGCTGCTTACTGGAGGTCTCTATGGCGTGCGTGTATTGCTCCAGGCGGTCGTCGATCTTGCTTATTGGAAGAGGGGGTTCGCTCTTCTTTATGCTGTTGCTCTTCTGGATGGAAAGGTTCAAGCACTCTGTCCTTTCAGTTATCTTTACAGTTGTTGCAATGGTTCCTTCACTCTCTCCATCACTGCTCACTGAGAGCCTACGAACGGCTTCCACTTCTGCCTCCCACCTCCTCCTGGGTGTCTCTGATTGGTCCTGACCCTCTGGTCTAGAGAAAAAATAACCAAGTTTCTCCCCCATTTTCTTTGGTCCTCTTCGGGTACCCTCATGGCTTTTTAAGCTCATAACTCCCAAATTCTCCATCCAACTGACAATGTAAATTTTTAAAAAAAACCTTTGTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGATCTTCCATGTAAACCTTC