ORFeome > luc7l3 ORF1 – XORFeome v1.0

luc7l3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: luc7l3
Gene ID: 5816095
Gene Page ID: 5815903
ORF Xenbase ID: 17282775

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123281
Original XGC clone length: 1293

Human orthology & disease relationships

NCBI Entrez ID: 51747
Ensembl gene IDs: ENSG00000108848
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 154500,253300,253400,253550,600334,603689,604145,608807,608808

Library Location

Plate ID: GDExl11091
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ838740
dbEST ID: 79656442
Trimmed Sequence: ATGCTTTCGGCAGCACAGCTCTTGGATGAGCTGATGGGAAGGGACCGGAATTTGGCTCCGGACGAGAAGCGGACAAACGTGCACTGGGATCATGAGAATGTGTGCAAATACTATCTTTGTGAATTTTGTCCAGCAGAATTGTTCACCAATACACGTTCAGATTTGGGTCCATGTGAAAAGATTCATGATGAAAATCTACGAAAACAGTACGAGAAGAGCTCCCGTTACCTGAAGTGTGGCTACGAGAAGGACTTTTTGCGTTATTTGCAAAGCTTGCTGGCTGAAGTGGAACGCCGAATACGTAGAGGTCACGCGCGACTGGCTCTTTCTCAGTCTCAACAGGCTTCTGGATCTGTTGGTCCAGCTGGAAAAAATGATGAGAAGGTTCAAGTATTAACAGATAAAATTGAAGTGTTATTGGAGCAGATTGAGGAGCTTGGTTCTGAAGGAAAGGTAGAGGAAGCTCAAGGGATGATGAAGCTTGTTGAACAGCTAAAAGAAGAGCGGGAACTGCTTAACTCTACAACATCGACAATTGAAAGTTTTGCAGCCCAAGAGAAACAAATGGAAGTCTGTGAAGTTTGTGGTGCCTTTTTAATTGTTGGAGATGCTCATTCTAGAGTAGACGATCACCTTATGGGGAAACAGCACATGGGCTATGCCCAAATTAGAAGTACAGTAGAAGAAATTAAAGGAAAAAAATGAAAAAAAAATCTTTCAAACCCAGAATCGGAATGAATGGTTCCAGAAAAAAACCGAAATGATTAAAAAATGGTGGGAAAAGAAAAAAGAAACCGGGAAAAAAGAAAGAAGAAAAAAAAAAAAA
Full Trace Sequence: TCGGGGGCCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTTTCGGCAGCACAGCTCTTGGATGAGCTGATGGGAAGGGACCGGAATTTGGCTCCGGACGAGAAGCGGACAAACGTGCACTGGGATCATGAGAATGTGTGCAAATACTATCTTTGTGAATTTTGTCCAGCAGAATTGTTCACCAATACACGTTCAGATTTGGGTCCATGTGAAAAGATTCATGATGAAAATCTACGAAAACAGTACGAGAAGAGCTCCCGTTACCTGAAGTGTGGCTACGAGAAGGACTTTTTGCGTTATTTGCAAAGCTTGCTGGCTGAAGTGGAACGCCGAATACGTAGAGGTCACGCGCGACTGGCTCTTTCTCAGTCTCAACAGGCTTCTGGATCTGTTGGTCCAGCTGGAAAAAATGATGAGAAGGTTCAAGTATTAACAGATAAAATTGAAGTGTTATTGGAGCAGATTGAGGAGCTTGGTTCTGAAGGAAAGGTAGAGGAAGCTCAAGGGATGATGAAGCTTGTTGAACAGCTAAAAGAAGAGCGGGAACTGCTTAACTCTACAACATCGACAATTGAAAGTTTTGCAGCCCAAGAGAAACAAATGGAAGTCTGTGAAGTTTGTGGTGCCTTTTTAATTGTTGGAGATGCTCATTCTAGAGTAGACGATCACCTTATGGGGAAACAGCACATGGGCTATGCCCAAATTAGAAGTACAGTAGAAGAAATTAAAGGAAAAAAATGAAAAAAAAATCTTTCAAACCCAGAATCGGAATGAATGGTTCCAGAAAAAAACCGAAATGATTAAAAAATGGTGGGAAAAGAAAAAAGAAACCGGGAAAAAAGAAAGAAGAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTTTCGGCAGCACAGCTCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838739
dbEST ID: 79656441
Trimmed Sequence: ATTGGACTGAGTGTCACCTTCAGATTTATTGCCTTCGTTCGCCCCATTGACCTCAACCTGTGCAACGGATTCCCTTGATTCAGTTTTTCTAGATTCACTCGGTTTCTCTCGACTGCTGGATTCTCTGCTTTTTTTGTCATCAGAGCTTCGTTTTTCTTTTTCCTTAGATTTTCTGTCCCGGTCCCTCTCCCTACTTCTGCTTTTGTGTTTGTATGATTTCCGTTCTCTGCTTTTAGACCTCCTCTTTTCCCTGCTTCGGGATCTGTGCTTTCTTTCTGTTCTGTTGTGACTTTGGCTTCTTTGGCGCTCTCTACTCCTGCTTCTCTTCCGATCTCTACTCCTTGACCTCTTATGGTCACGGGTTCTGCTTCCGCGTCTGTCGGATGTTCTGCTTGAATTTCTGCTACGAGAGCAGCTTCTTTTGCGTTTCTCCCTCTCACGATTTTTCTCCTTTTCTTTAGCTTCCTCCTCTCTCCGTCTTTTTTTTTCTCTCTCTTCTCTCTCCTGTTCCTTTTCTTTCTCACGATCTTTATCATCTCGCTCTTTCTTTGAACACTCATCCCGATCTGGGTCTGAAGATTTTTTTCTCATTTTTTCCTTTAATTTCTCTACTGTACTTTTAATTTTGGCATACCCCATGTGCTGTTTTCCCATAAGGTGATCGTCTACTCTAAACTGACCATCTCCCAACATTAAAAAGGCACCACAAACTTCAAAAAATTTCCCTTTGTTTTCTTTTTGGCTGTGAAACTTTTTAATTTGGCGAAGTTTTTAAAAG
Full Trace Sequence: GGGAAAACAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTGGACTGAGTGTCACCTTCAGATTTATTGCCTTCGTTCGCCCCATTGACCTCAACCTGTGCAACGGATTCCCTTGATTCAGTTTTTCTAGATTCACTCGGTTTCTCTCGACTGCTGGATTCTCTGCTTTTTTTGTCATCAGAGCTTCGTTTTTCTTTTTCCTTAGATTTTCTGTCCCGGTCCCTCTCCCTACTTCTGCTTTTGTGTTTGTATGATTTCCGTTCTCTGCTTTTAGACCTCCTCTTTTCCCTGCTTCGGGATCTGTGCTTTCTTTCTGTTCTGTTGTGACTTTGGCTTCTTTGGCGCTCTCTACTCCTGCTTCTCTTCCGATCTCTACTCCTTGACCTCTTATGGTCACGGGTTCTGCTTCCGCGTCTGTCGGATGTTCTGCTTGAATTTCTGCTACGAGAGCAGCTTCTTTTGCGTTTCTCCCTCTCACGATTTTTCTCCTTTTCTTTAGCTTCCTCCTCTCTCCGTCTTTTTTTTTCTCTCTCTTCTCTCTCCTGTTCCTTTTCTTTCTCACGATCTTTATCATCTCGCTCTTTCTTTGAACACTCATCCCGATCTGGGTCTGAAGATTTTTTTCTCATTTTTTCCTTTAATTTCTCTACTGTACTTTTAATTTTGGCATACCCCATGTGCTGTTTTCCCATAAGGTGATCGTCTACTCTAAACTGACCATCTCCCAACATTAAAAAGGCACCACAAACTTCAAAAAATTTCCCTTTGTTTTCTTTTTGGCTGTGAAACTTTTTAATTTGGCGAAGTTTTTAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGGACTGAGTGTCACCTT