ORFeome > lum ORF1 – XORFeome v1.0

lum ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: lum
Gene ID: 1004939
Gene Page ID: 1004933
ORF Xenbase ID: 17282781

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054282
Original XGC clone length: 1062

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ839365
dbEST ID: 79657067
Trimmed Sequence: ATGCATCTTCATTTTATTCCCTTCTTTGCAGTGCTAATTAGTGGCATTTCATGCACATTTTATGACTATGGATATGATGGAGGATATGCTGCTCCAGAGGGAGATTACTACGCTTCAAGTTTATCTTTGGGACCATCTACTGCAAACTGTGCTCCAGAATGCACCTGTCCTTTCAACTATCCCTCTGCAATGTATTGTGACAGCCGCAAATTAAAGACAATCCCAATGATTCCTGCTGGAATACAATACTTGTACCTGCAAAGCAACATGATTGAGGCTATAGAAGAGAATGCTTTTAAGAATGTTACTGAATTGAAATGGCTTATTCTAGACCACAACCAGTTGACCAATGGCAAAATAAAGAAAAATGCTTTTTCCAGTCTAAAACATCTAGTAAAGTTATATATCAGTTTTAACAACCTCACTGAATTGGTAGGGCCACTACCAAAAACTATGGAGGATCTTCGTGTAACCAACAATAAAATCTCAAAGATTACTCCTAACATTTTGGAAGGTCTAGAAAATTTAACTCACATTTATCTGCAGCACAATGCTCTAAAAGAAGATTCAATTTCAGGGGCATTTAAAGGTCTGAGACAGCTTTCATATCTTGACTTTAGTTTTAATGAAATGACAAAGTTACCCAAGGGACTTCCACCAAGCATAACTACTTTATATTTTGACAACAATAAAAATACTAAGTATCCCAAATGAGTAATTTCCAAGGTTTTAAAAGCTTTGCAATTATCCTTCGCCTGTTCCACAAACAAATTGAAAAAATGGCAGGGGGTACCTGGGAAAAGGCCTTTCCAATATC
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCATCTTCATTTTATTCCCTTCTTTGCAGTGCTAATTAGTGGCATTTCATGCACATTTTATGACTATGGATATGATGGAGGATATGCTGCTCCAGAGGGAGATTACTACGCTTCAAGTTTATCTTTGGGACCATCTACTGCAAACTGTGCTCCAGAATGCACCTGTCCTTTCAACTATCCCTCTGCAATGTATTGTGACAGCCGCAAATTAAAGACAATCCCAATGATTCCTGCTGGAATACAATACTTGTACCTGCAAAGCAACATGATTGAGGCTATAGAAGAGAATGCTTTTAAGAATGTTACTGAATTGAAATGGCTTATTCTAGACCACAACCAGTTGACCAATGGCAAAATAAAGAAAAATGCTTTTTCCAGTCTAAAACATCTAGTAAAGTTATATATCAGTTTTAACAACCTCACTGAATTGGTAGGGCCACTACCAAAAACTATGGAGGATCTTCGTGTAACCAACAATAAAATCTCAAAGATTACTCCTAACATTTTGGAAGGTCTAGAAAATTTAACTCACATTTATCTGCAGCACAATGCTCTAAAAGAAGATTCAATTTCAGGGGCATTTAAAGGTCTGAGACAGCTTTCATATCTTGACTTTAGTTTTAATGAAATGACAAAGTTACCCAAGGGACTTCCACCAAGCATAACTACTTTATATTTTGACAACAATAAAAATACTAAGTATCCCAAATGAGTAATTTCCAAGGTTTTAAAAGCTTTGCAATTATCCTTCGCCTGTTCCACAAACAAATTGAAAAAATGGCAGGGGGTACCTGGGAAAAGGCCTTTCCAATATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCATCTTCATTTTATTCCCTTC

Sequences - 3ʹ (reverse) EST

Accession: JZ839364
dbEST ID: 79657066
Trimmed Sequence: ACCTAGGTCTATTTCACTGGCCACACGGAGACAGCTGTACATGTCCTGGGGAAGGTCGATTCTGCTGATATTGTTTCCATCTAAACGAAGGTGTCGGATTTTGGAGTATTCCAGTGGTCCAATAACTTTACAAAAGCTGTTCAGGGTGAATTTTTGAATTTTGTTTACTTGCATGTAGAGGTTTTCCAGACCTTCGTTCACAGCTGGAATGCTCCCAAGTTCATTGAATGAAAGATCCAGCTCAACAAGACTTGAGATATTGAAAGCATTTCCAGGTACCCCTGCATCTTTCAATTTGTTGTTGGACAGGCGAAGATACTGCAAAGCTTTAAAACCTTGGAAATACTCATCTGGGATATTAGTAATTTTATTGTTGTCAAAATATAAAGTAGTTATGCTTGGTGGAAGTCCCTTGGGTAACTTTGTCATTTCATTAAAACTAAAGTCAAGATATGAAAGCTGTTTCAGACCTTTAAATGCCCCTGAAATTGAATCTTCTTTTAGAGCATTGTGCTGCAGATAAATGTGAGTTAAATTTTCTAGACCTTCCAAAATGTTAGGAGTAATCTTTGAGATTTTATTGTTGGTTACACGAAGATCCTCCATAGTTTTTGGTAGTGGCCCTACCAATTCAGTGAGGTTGTTAAAACTGATATATAACTTTTACAAAAATGTTTTAGACTGGGAAAAAGCATTTTTTCTTTATTTTGCCCATTGGGCCAAATGGGTTGGGGGGTCCAAAAAAAAAAGCCCAATTTTCAATTTCCATT
Full Trace Sequence: CGAGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCTAGGTCTATTTCACTGGCCACACGGAGACAGCTGTACATGTCCTGGGGAAGGTCGATTCTGCTGATATTGTTTCCATCTAAACGAAGGTGTCGGATTTTGGAGTATTCCAGTGGTCCAATAACTTTACAAAAGCTGTTCAGGGTGAATTTTTGAATTTTGTTTACTTGCATGTAGAGGTTTTCCAGACCTTCGTTCACAGCTGGAATGCTCCCAAGTTCATTGAATGAAAGATCCAGCTCAACAAGACTTGAGATATTGAAAGCATTTCCAGGTACCCCTGCATCTTTCAATTTGTTGTTGGACAGGCGAAGATACTGCAAAGCTTTAAAACCTTGGAAATACTCATCTGGGATATTAGTAATTTTATTGTTGTCAAAATATAAAGTAGTTATGCTTGGTGGAAGTCCCTTGGGTAACTTTGTCATTTCATTAAAACTAAAGTCAAGATATGAAAGCTGTTTCAGACCTTTAAATGCCCCTGAAATTGAATCTTCTTTTAGAGCATTGTGCTGCAGATAAATGTGAGTTAAATTTTCTAGACCTTCCAAAATGTTAGGAGTAATCTTTGAGATTTTATTGTTGGTTACACGAAGATCCTCCATAGTTTTTGGTAGTGGCCCTACCAATTCAGTGAGGTTGTTAAAACTGATATATAACTTTTACAAAAATGTTTTAGACTGGGAAAAAGCATTTTTTCTTTATTTTGCCCATTGGGCCAAATGGGTTGGGGGGTCCAAAAAAAAAAGCCCAATTTTCAATTTCCATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCTAGGTCTATTTCACTGGCCAC