ORFeome > lypla2 ORF1 – XORFeome v1.0

lypla2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lypla2
Gene ID: 951396
Gene Page ID: 951390
ORF Xenbase ID: 17282805

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044315
Original XGC clone length: 696

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11007
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ823571
dbEST ID: 79641273
Trimmed Sequence: ATGTGCGGGAATAACATGTCTGTACCGCTACTCACTGATGCCGTGACCGTACCTGCGGGGGAACGGGAGACCGGAGCGGTGATATTCCTTCATGGACTCGGTGACACGGGACATGGCTGGGCTGAGACACTATCGGCCATCAAACTGCCACATGTGAAATATATTTGCCCCCATGCGCCACGTATTCCGGTCACTCTGAACATGAAGATGGTGATGCCTGCATGGTTTGATCTGATGGGTCTGAGTCCTGATGCTCCAGAAGATGAGGCAGGAATTAAGAAGGCAGCAGAAAGCATTAAGACTATCATTGAGCATGAAGTAAAGAATGGGATTCCGGCCAATAGGATTGTCTTGGGAGGTTTCTCTCAGGGAGGGGCTCTTTCTATGTACACAGCCCTCACCTGCCAACACAAACTGGCTGGAGTAGTTGGGCTAAGCTGTTGGTTACCTCTTCACAAGACATTCCCTCAGGCTGCAAGTGGTGTAAATAAGGAAATCTCTGTCATGCAATGTCATGGAGAGGCTGACCCCATGATTCCTGTTCGCTTTGGAAATCTCACCTCAGAGAAACTGAAATCGGTGTTGAACCCTTCAAAAGTCCAGTTCAAATCGTATCCTGGAGTCATGCATAGCACCAATCAGGAGGAAATGATGGCAGTGAAAGATTTCTTGCAGAAAGTGCTCCCACGAATGTT
Full Trace Sequence: CAATATTGATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGCGGGAATAACATGTCTGTACCGCTACTCACTGATGCCGTGACCGTACCTGCGGGGGAACGGGAGACCGGAGCGGTGATATTCCTTCATGGACTCGGTGACACGGGACATGGCTGGGCTGAGACACTATCGGCCATCAAACTGCCACATGTGAAATATATTTGCCCCCATGCGCCACGTATTCCGGTCACTCTGAACATGAAGATGGTGATGCCTGCATGGTTTGATCTGATGGGTCTGAGTCCTGATGCTCCAGAAGATGAGGCAGGAATTAAGAAGGCAGCAGAAAGCATTAAGACTATCATTGAGCATGAAGTAAAGAATGGGATTCCGGCCAATAGGATTGTCTTGGGAGGTTTCTCTCAGGGAGGGGCTCTTTCTATGTACACAGCCCTCACCTGCCAACACAAACTGGCTGGAGTAGTTGGGCTAAGCTGTTGGTTACCTCTTCACAAGACATTCCCTCAGGCTGCAAGTGGTGTAAATAAGGAAATCTCTGTCATGCAATGTCATGGAGAGGCTGACCCCATGATTCCTGTTCGCTTTGGAAATCTCACCTCAGAGAAACTGAAATCGGTGTTGAACCCTTCAAAAGTCCAGTTCAAATCGTATCCTGGAGTCATGCATAGCACCAATCAGGAGGAAATGATGGCAGTGAAAGATTTCTTGCAGAAAGTGCTCCCACGAATGTTGCCAACTTTCTTGTACAAAGTTGGCATTANTAGAAAGCATTGCTTATCANTTTGTTGCCACGGAACAGGTCACTATCAGTCAAAAATAAAATCATTATTTTGCCCCTTCCCCGCTAAATATCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGCGGGAATAACATGTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ828869
dbEST ID: 79646571
Trimmed Sequence: CATTCGTGGGAGCACTTTCTGCAAGAAATCTTTCACTGCCATCATTTCCTCCTGATTGGTGCTATGCATGACTCCAGGATACGATTTGAACTGGACTTTTGAAGGGTTCAACACCGATTTCAGTTTCTCTGAGGTGAGATTTCCAAAGCGAACAGGAATCATGGGGTCAGCCTCTCCATGACATTGCATGACAGAGATTTCCTTATTTACACCACTTGCAGCCTGAGGGAATGTCTTGTGAAGAGGTAACCAACAGCTTAGCCCAACTACTCCAGCCAGTTTGTGTTGGCAGGTGAGGGCTGTGTACATAGAAAGAGCCCCTCCCTGAGAGAAACCTCCCAAGACAATCCTATTGGCCGGAATCCCATTCTTTACTTCATGCTCAATGATAGTCTTAATGCTTTCTGCTGCCTTCTTAATTCCTGCCTCATCTTCTGGAGCATCAGGACTCATACCCATCAGATCAAACCATGCAGGCATCACCATCTTCATGTTCAGAGTGACCGGAATACGTGGCGCATGGGGGCAAATATATTTCACATGTGGCAGTTTGATGGCCGATAGTGTCTCAACCCAGCCATGTCCCGTGTCACCGAGTCCATGAAGGAATATCACCCGCTCGGTCTCCCGTTTCCCCGCAGGTACGGTCACCGGCTTCGTGAATAACGGTACAGACATGTTATTTCCCGCAATGGTGCCCACCTTTTTTGGACCAAGTTTGGGAATTTAAA
Full Trace Sequence: CATGCAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATTCGTGGGAGCACTTTCTGCAAGAAATCTTTCACTGCCATCATTTCCTCCTGATTGGTGCTATGCATGACTCCAGGATACGATTTGAACTGGACTTTTGAAGGGTTCAACACCGATTTCAGTTTCTCTGAGGTGAGATTTCCAAAGCGAACAGGAATCATGGGGTCAGCCTCTCCATGACATTGCATGACAGAGATTTCCTTATTTACACCACTTGCAGCCTGAGGGAATGTCTTGTGAAGAGGTAACCAACAGCTTAGCCCAACTACTCCAGCCAGTTTGTGTTGGCAGGTGAGGGCTGTGTACATAGAAAGAGCCCCTCCCTGAGAGAAACCTCCCAAGACAATCCTATTGGCCGGAATCCCATTCTTTACTTCATGCTCAATGATAGTCTTAATGCTTTCTGCTGCCTTCTTAATTCCTGCCTCATCTTCTGGAGCATCAGGACTCATACCCATCAGATCAAACCATGCAGGCATCACCATCTTCATGTTCAGAGTGACCGGAATACGTGGCGCATGGGGGCAAATATATTTCACATGTGGCAGTTTGATGGCCGATAGTGTCTCAACCCAGCCATGTCCCGTGTCACCGAGTCCATGAAGGAATATCACCCGCTCGGTCTCCCGTTTCCCCGCAGGTACGGTCACCGGCTTCGTGAATAACGGTACAGACATGTTATTTCCCGCAATGGTGCCCACCTTTTTTGGACCAAGTTTGGGAATTTAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATTCGTGGGAGCACTTT