ORFeome > lyrm7 ORF1 – XORFeome v1.0

lyrm7 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: lyrm7
Gene ID: 6255076
Gene Page ID: 963574
ORF Xenbase ID: 17282823

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082902
Original XGC clone length: 381

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ839844
dbEST ID: 79657546
Trimmed Sequence: ATGGAGAGTAAGATGAAGGTGTTGAAACTTTTCAGAACGTTGCATCGCACAAGGCAGTGTGTATTTCAGAATGACCATCGTGCACTGGAAGCTGCCAGACAAAGAATCAATGAAGAGTTTAAGAAAAACAAAAGGGAATGTTCTCCTGCAAAAATATCAGAGTTGCTGAAATTTGGAACTGATGTAGAAATTCTTCTCAGAACATCTGTTGTTCAGGGTATTCATAAAGATTCAGATACATTAGGTATGCCATGGTTATTGCGTTTTCTTACTCGTAACTTCATTGTATACTACAGTGCCAGAAATATGAGTAGAACAGGGATTGCAGAGGCTGTTCTGTGTTTAGATTGTTATCCACTACAGAAGATTGTTATCCCATT
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGAGTAAGATGAAGGTGTTGAAACTTTTCAGAACGTTGCATCGCACAAGGCAGTGTGTATTTCAGAATGACCATCGTGCACTGGAAGCTGCCAGACAAAGAATCAATGAAGAGTTTAAGAAAAACAAAAGGGAATGTTCTCCTGCAAAAATATCAGAGTTGCTGAAATTTGGAACTGATGTAGAAATTCTTCTCAGAACATCTGTTGTTCAGGGTATTCATAAAGATTCAGATACATTAGGTATGCCATGGTTATTGCGTTTTCTTACTCGTAACTTCATTGTATACTACAGTGCCAGAAATATGAGTAGAACAGGGATTGCAGAGGCTGTTCTGTGTTTAGATTGTTATCCACTACAGAAGATTGTTATCCCATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAAAAAAAAAAAAAAAAAAAAAATTATTAATGTTACATACTACCCCCCGCGCAGAAAAGAAAAGCTCCCCCGGACCCAGGGGAGCCAGAGGGGTCGTCTTGTGGGAGGGGTGGAGGCCCCAACCCCGGGAAACACCCCGGGGCGGGTTGGTAGTGGTTTGCGGTTGCTTCGGGGCGGGGGCGGGGGGGGGGGAAACAAAACCAAAAAAAAAGAGGGGGAGAGGGGAGGGGGGGGGGGTTTTTGGTTTTTTTTTTTATTTTTTTTTGTTTTTGTTGTTTTTTGTTTCTCTTGTTTTATCATAAAAATAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAGTAAGATGAAGGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839843
dbEST ID: 79657545
Trimmed Sequence: TGGGATAACAATCTTCTGTAGTGGATAACAATCTAAACACAGAACAGCCTCTGCAATCCCTGTTCTACTCATATTTCTGGCACTGTAGTATACAATGAAGTTACGAGTAAGAAAACGCAATAACCATGGCATACCTAATGTATCTGAATCTTTATGAATACCCTGAACAACAGATGTTCTGAGAAGAATTTCTACATCAGTTCCAAATTTCAGCAACTCTGATATTTTTGCAGGAGAACATTCCCTTTTGTTTTTCTTAAACTCTTCATTGATTCTTTGTCTGGCAGCTTCCAGTGCACGATGGTCATTCTGAAATACACACTGCCTTGTGCGATGCAACGTTCTGAAAAGTTTCAACACCTTCATCTTACTCTCCATGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGGATAACAATCTTCTGTAGTGGATAACAATCTAAACACAGAACAGCCTCTGCAATCCCTGTTCTACTCATATTTCTGGCACTGTAGTATACAATGAAGTTACGAGTAAGAAAACGCAATAACCATGGCATACCTAATGTATCTGAATCTTTATGAATACCCTGAACAACAGATGTTCTGAGAAGAATTTCTACATCAGTTCCAAATTTCAGCAACTCTGATATTTTTGCAGGAGAACATTCCCTTTTGTTTTTCTTAAACTCTTCATTGATTCTTTGTCTGGCAGCTTCCAGTGCACGATGGTCATTCTGAAATACACACTGCCTTGTGCGATGCAACGTTCTGAAAAGTTTCAACACCTTCATCTTACTCTCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAGACAAAAAAAAAAATATAAACAAATATAAACTGGAAAGCAGGGCGGAAAAAAAACAAAAAAACCCCGCAACACTGGGGGGGTCGGTGCTCTGTTTTGTGAGGGGGGAGAGTGGGGGGACAAGAGAAATAAACAGGGGGGGTTCTTATTGGTGTGATTTTTTTTATGGGCACACCCCCCCGGCCCAGAAAAATAACAAAAGGAGGGGGGGGGGGGGGGGGGAGGGGGGTTTGTTGGTGTGTGTTAAAATTTTTTTTTTGTGGGGGTTTTTTTTTTTCTACGATGTGTTTATGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGGATAACAATCTTCTGTAGTGG