ORFeome > magoh ORF1 – XORFeome v1.0

magoh ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: magoh
Gene ID: 493544
Gene Page ID: 493539
ORF Xenbase ID: 17282949

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053764
Original XGC clone length: 441

Human orthology & disease relationships

NCBI Entrez ID: 4116
Ensembl gene IDs: ENSG00000162385
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,162210,164300,193520,214450,256710,300590,303600,609065,609227

Library Location

Plate ID: GDExl11001
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ839219
dbEST ID: 79656921
Trimmed Sequence: ATGGGGAGCGATTTCTATCTCCGCTATTATGTTGGACACAAGGGCAAGTTTGGACATGAGTTCTTGGAGTTCGAGTTTCGGCCTGACGGAAAACTCCGTTATGCCAACAACAGCAATTATAAGAATGATGTTATGATCAGGAAGGAGGCCTATGTACACAAAAGTGTAATGGAGGAATTAAAAAGGATAATAGATGACAGTGAGGTCACAAAAGAAGATGATGCATTGTGGCCGCCACCAGATAGAGTAGGACGGCAGGAGCTGGAGATAGTTATTGGTGATGAACACATTTCTTTTACTACGTCCAAAATTGGATCGCTTATCGATGTGAATCAGTCCAAAGATCCTGAGGGGTTAAGAGTATTCTACTACTTGGTTCAGGACCTGAAGTGTTTGGTTTTCAGTTTGATTGGACTTCACTTCAAAATTAAGCCCATCTT
Full Trace Sequence: GGTGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGAGCGATTTCTATCTCCGCTATTATGTTGGACACAAGGGCAAGTTTGGACATGAGTTCTTGGAGTTCGAGTTTCGGCCTGACGGAAAACTCCGTTATGCCAACAACAGCAATTATAAGAATGATGTTATGATCAGGAAGGAGGCCTATGTACACAAAAGTGTAATGGAGGAATTAAAAAGGATAATAGATGACAGTGAGGTCACAAAAGAAGATGATGCATTGTGGCCGCCACCAGATAGAGTAGGACGGCAGGAGCTGGAGATAGTTATTGGTGATGAACACATTTCTTTTACTACGTCCAAAATTGGATCGCTTATCGATGTGAATCAGTCCAAAGATCCTGAGGGGTTAAGAGTATTCTACTACTTGGTTCAGGACCTGAAGTGTTTGGTTTTCAGTTTGATTGGACTTCACTTCAAAATTAAGCCCATCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTAACAACTCTGGCCCGTGCCTCAAAATCTCCGATGGTACAAGCCAGTTTTAGTGGCAGTCCTCTCCTTATCACACGGGCTCCCTTTTATCTCCATTTTAATTGGCCTAACAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAGCGATTTCTATCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839218
dbEST ID: 79656920
Trimmed Sequence: GATGGGCTTAATTTTGAAGTGAAGTCCAATCAAACTGAAAACCAAACACTTCAGGTCCTGAACCAAGTAGTAGAATACTCTTAACCCCTCAGGATCTTTGGACTGATTCACATCGATNAGCGATCCAATTTTGGACGTAGTAAAAGAAATGTGTTCATCACCAATAACTATCTCCAGCTCCTGCCGTCCTACTCTATCTGGTGGCGGCCACAATGCATCATCTTCTTTTGTGACCTCACTGTCATCTATTATCCTTTTTAATTCCTCCATTACACTTTTGTGTACATAGGCCTCCTTCCTGATCATAACATCATTCTTATAATTGCTGTTGTTGGCATAACGGAGTTTTCCGTCAGGCCGAAACTCGAACTCCAAGAACTCATGTCCAAACTTGCCCTTGTGTCCACATAATAGCGGAGATAGAAATCGCTCCCCATGG
Full Trace Sequence: GGACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATGGGCTTAATTTTGAAGTGAAGTCCAATCAAACTGAAAACCAAACACTTCAGGTCCTGAACCAAGTAGTAGAATACTCTTAACCCCTCAGGATCTTTGGACTGATTCACATCGATNAGCGATCCAATTTTGGACGTAGTAAAAGAAATGTGTTCATCACCAATAACTATCTCCAGCTCCTGCCGTCCTACTCTATCTGGTGGCGGCCACAATGCATCATCTTCTTTTGTGACCTCACTGTCATCTATTATCCTTTTTAATTCCTCCATTACACTTTTGTGTACATAGGCCTCCTTCCTGATCATAACATCATTCTTATAATTGCTGTTGTTGGCATAACGGAGTTTTCCGTCAGGCCGAAACTCGAACTCCAAGAACTCATGTCCAAACTTGCCCTTGTGTCCACATAATAGCGGAGATAGAAATCGCTCCCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAGTTTGTTGCAACAAACAGGTCACTATTAGTCCAAATAAAATCATTATTTTGGGGCCCAACTCTAATACTGACCGTCGTTTTACAACAATTGAACTGGGCNTTTTAATAATCACCCGCTCTGCTGGAACCCGGGGTTCCCGGGTGACCACAGGAAGGGGAGGAAAAGGGGGGCAAGAAAAAAAAAAAAAATACCGGAGTGAGTTTCGAAGAGAGAAGAAACAGAAAGGGGAGAGGCCCCAGCAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGGGCTTAATTTTGAAGTGAAG