ORFeome > mak16 ORF1 – XORFeome v1.0

mak16 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mak16
Gene ID: 6254562
Gene Page ID: 5928118
ORF Xenbase ID: 17282967

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078464
Original XGC clone length: 906

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ839736
dbEST ID: 79657438
Trimmed Sequence: ATGCAGCATGATGATGTAATCTGGGATGTTGTGGGGAACAAGCAGTTCTGCTCTTTCAAAATAAAAACAAAGACACAGAACTTCTGTCGAAATGAATACAACATAACGGGGCTGTGCAATCGCTCCGCCTGCCCCCTAGCCAACAGCCAGTATGCCACCATCAAAGAGGAGAAAGGCATCTGCTATCTGTATATGAAGACAATAGAGAGAGCGGCCTTCCCAGCTCGCATGTGGGAGAGGGTACGACTGAGCAAGAATTATGAGCAGGCGCTGGAACAAATCGACGAGAACCTGATCTATTGGCCGCGCTTCATTAGACACAAGTGCAAGCAGAGATTCACCAAGATCACGCAGTACTTGATCCGCATCCGCAAGCTCACACTCAAGAGGCAACGTAAACTGGTTCCCCTGAGCCGGAAGGTGGAAAGGAGAGAAAAGAGGAGAGAGGAAAAGGCTCTGGTGGCGGCTCAGCTGGATAATGCCATCGAGAAGGAATTACTGGAGCGTCTCAAACAGGGAGCGTATGGGGATATTTATAACTTCCCAATTCAAGCTTTTGATAAAGCACTGGAACAGCAGGAAGATGCAAGTGCCTCAGAGTCATCTGCCGACGAAAANGAAGGAAGATGATGAAGAGATTGCAAGAGGGAGTTTGTGGAGGATGANCACGTTGACGAAAGTGACCTGAGTGATTTTGAGGACATGGATAACTGGGGGGCTAGNCGGTGACGAGAACAACATTTCCATGAAGAACCAGAAAGAGTCATCGGGAAGGAGGAAAGAAGAAGCCCGGGAAAACCAAAATTCCAAGGGCAAAGGGC
Full Trace Sequence: CGGCCCCAAATAATAGATTTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGCATGATGATGTAATCTGGGATGTTGTGGGGAACAAGCAGTTCTGCTCTTTCAAAATAAAAACAAAGACACAGAACTTCTGTCGAAATGAATACAACATAACGGGGCTGTGCAATCGCTCCGCCTGCCCCCTAGCCAACAGCCAGTATGCCACCATCAAAGAGGAGAAAGGCATCTGCTATCTGTATATGAAGACAATAGAGAGAGCGGCCTTCCCAGCTCGCATGTGGGAGAGGGTACGACTGAGCAAGAATTATGAGCAGGCGCTGGAACAAATCGACGAGAACCTGATCTATTGGCCGCGCTTCATTAGACACAAGTGCAAGCAGAGATTCACCAAGATCACGCAGTACTTGATCCGCATCCGCAAGCTCACACTCAAGAGGCAACGTAAACTGGTTCCCCTGAGCCGGAAGGTGGAAAGGAGAGAAAAGAGGAGAGAGGAAAAGGCTCTGGTGGCGGCTCAGCTGGATAATGCCATCGAGAAGGAATTACTGGAGCGTCTCAAACAGGGAGCGTATGGGGATATTTATAACTTCCCAATTCAAGCTTTTGATAAAGCACTGGAACAGCAGGAAGATGCAAGTGCCTCAGAGTCATCTGCCGACGAAAANGAAGGAAGATGATGAAGAGATTGCAAGAGGGAGTTTGTGGAGGATGANCACGTTGACGAAAGTGACCTGAGTGATTTTGAGGACATGGATAACTGGGGGGCTAGNCGGTGACGAGAACAACATTTCCATGAAGAACCAGAAAGAGTCATCGGGAAGGAGGAAAGAAGAAGCCCGGGAAAACCAAAATTCCAAGGGCAAAGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGCATGATGATGTAATCTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839735
dbEST ID: 79657437
Trimmed Sequence: TGTCACTTTGGCTTTGTGCTGCGGCTCTGTTTCTTGTTCATACTCTATCTCCACCCGCGGACGTTTCCTGATTAAATGTCCTTTCAGTGGGGCCTTGCCCTTGGATTTTGCTTTGCCGGCCTCTTCTTCCTCCTCCGATGACTCTTCCTCGCTCTCACTGGAATGTTTGTCTTCGTCACCGCTAGCCCCCAGTTTATCCATGTCCTCAAAATCACTCAGGTCACTTTCGTCAACGTTGTCATCTTCCACAAACTCCCTCTTGCCAATCTCTTCATCATCTTCCTCTTCTTCGTCGGCAGATGACTCTGAGGCACTTGCATCTTCCTGCTGTTCCAGTGCTTTATCAAAAGCTTGAATTGGGAAGTTATAAATATCCCCATACGCTCCCTGTTTGAGACGCTCCAGTAATTCCTTCTCGATGGCATTATCCAGCTGAGCCGCCACCAGAGCCTTTTCCTCTCTCCTCTTTTCTCTCCTTTCCACCTTCCGGCTCAGGGGAACCAGTTTACGTTGCCTCTTGAGTGTGAGCTTGCGGATGCGGATCAAGTACTGCGTGATCTTGGTGAATCTCTGCTTGCACTTGTGTCTAAGGAAGCGCGGCCAATAAATCAGGGTTCTCGTCGAATTGTTCCCGCCCCTGCTCCTAATTCCTGCCCAGTTCGAACCCTCTCCCACCTTCCAACCCTGGAAAGGCCCCCCCTCTTCTATGGTCCTCCATGTTACGAATGGCAAAATGCCCCTTTCTCCCCCCTTT
Full Trace Sequence: GAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTCACTTTGGCTTTGTGCTGCGGCTCTGTTTCTTGTTCATACTCTATCTCCACCCGCGGACGTTTCCTGATTAAATGTCCTTTCAGTGGGGCCTTGCCCTTGGATTTTGCTTTGCCGGCCTCTTCTTCCTCCTCCGATGACTCTTCCTCGCTCTCACTGGAATGTTTGTCTTCGTCACCGCTAGCCCCCAGTTTATCCATGTCCTCAAAATCACTCAGGTCACTTTCGTCAACGTTGTCATCTTCCACAAACTCCCTCTTGCCAATCTCTTCATCATCTTCCTCTTCTTCGTCGGCAGATGACTCTGAGGCACTTGCATCTTCCTGCTGTTCCAGTGCTTTATCAAAAGCTTGAATTGGGAAGTTATAAATATCCCCATACGCTCCCTGTTTGAGACGCTCCAGTAATTCCTTCTCGATGGCATTATCCAGCTGAGCCGCCACCAGAGCCTTTTCCTCTCTCCTCTTTTCTCTCCTTTCCACCTTCCGGCTCAGGGGAACCAGTTTACGTTGCCTCTTGAGTGTGAGCTTGCGGATGCGGATCAAGTACTGCGTGATCTTGGTGAATCTCTGCTTGCACTTGTGTCTAAGGAAGCGCGGCCAATAAATCAGGGTTCTCGTCGAATTGTTCCCGCCCCTGCTCCTAATTCCTGCCCAGTTCGAACCCTCTCCCACCTTCCAACCCTGGAAAGGCCCCCCCTCTTCTATGGTCCTCCATGTTACGAATGGCAAAATGCCCCTTTCTCCCCCCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTCACTTTGGCTTTGTGCT