ORFeome > mak16 ORF2 – XORFeome v1.0

mak16 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mak16
Gene ID: 5928260
Gene Page ID: 5928118
ORF Xenbase ID: 17282973

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043795
Original XGC clone length: 915

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ823956
dbEST ID: 79641658
Trimmed Sequence: ATGCAGCATGATGATGTAATCTGGGATGTTGTTGGGAACAAACAGTTCTGCTCCTTCAAAATAAAAACAAAGACACAGAACTTCTGTCGAAATGAATTCAACATAACTGGGCTGTGCAATCGCTCTGCCTGCCCCCTAGCCAACAGCCAGTATGCCACCATCAAAGAGGAGAAAGGCATCTGCTATTTGTATATGAAGACAATCGAGAGAGCAGCCTTCCCAGCTCGGATGTGGGAGAGGGTACGACTGAGCAAGAATTATGAGCAGGCTCTGGAACAAATTGACGAGAACCTAATCTATTGGCCGCGCTTTATCAGACACAAGTGCAAGCAGAGGTTCACAAAAATCACACAGTACTTGATCCGCATCCGCAAGCTCACTCTCAAGAGGCAACGCAAACTGGTTCCCCTGAGCAGGAAGGTGGAAAGGAGGGAAAAGCGGAGAGAGGAAAAGGCCCTGGTGGCGGCCCAGCTGGACAATGCCATAGAGAAGGAATTACTGGAGCGGCTCAAACAGGGAGCGTATGGGGATATTTATAACTTTCCCATCCAAGCTTTTGATAAAGCACTGGAACAGCAGGACGAGGCAAGCGCCTCCGAGTCATCTGATGAAGAAGAGGAAGATGATGAAGAGAGCGGCAAGAGGGAGTTTGTGGAAGACGATGATGTTGAAGAAAGTGACTTGAGTGATTTTGAGGACATGGATAAACTTGGGGCTAGCAGTGACGAGGACNAGCCTTCCAGTGAGAGCGAGGAAGAGTCATCCCGGGGAAGAAGATA
Full Trace Sequence: CAGTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGCATGATGATGTAATCTGGGATGTTGTTGGGAACAAACAGTTCTGCTCCTTCAAAATAAAAACAAAGACACAGAACTTCTGTCGAAATGAATTCAACATAACTGGGCTGTGCAATCGCTCTGCCTGCCCCCTAGCCAACAGCCAGTATGCCACCATCAAAGAGGAGAAAGGCATCTGCTATTTGTATATGAAGACAATCGAGAGAGCAGCCTTCCCAGCTCGGATGTGGGAGAGGGTACGACTGAGCAAGAATTATGAGCAGGCTCTGGAACAAATTGACGAGAACCTAATCTATTGGCCGCGCTTTATCAGACACAAGTGCAAGCAGAGGTTCACAAAAATCACACAGTACTTGATCCGCATCCGCAAGCTCACTCTCAAGAGGCAACGCAAACTGGTTCCCCTGAGCAGGAAGGTGGAAAGGAGGGAAAAGCGGAGAGAGGAAAAGGCCCTGGTGGCGGCCCAGCTGGACAATGCCATAGAGAAGGAATTACTGGAGCGGCTCAAACAGGGAGCGTATGGGGATATTTATAACTTTCCCATCCAAGCTTTTGATAAAGCACTGGAACAGCAGGACGAGGCAAGCGCCTCCGAGTCATCTGATGAAGAAGAGGAAGATGATGAAGAGAGCGGCAAGAGGGAGTTTGTGGAAGACGATGATGTTGAAGAAAGTGACTTGAGTGATTTTGAGGACATGGATAAACTTGGGGCTAGCAGTGACGAGGACNAGCCTTCCAGTGAGAGCGAGGAAGAGTCATCCCGGGGAAGAAGATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGCATGATGATGTAATCTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829265
dbEST ID: 79646967
Trimmed Sequence: TGTCACTTTGGCTTTCTGCTGTGGCTCAGTTTCTTGTTCATACTCTATCTCCACATGCGGACGTTTCCTGATTAAATGTCCTTTCAGTGGGGCCTTGCCCTTCGACTTTGCTTTGGGGGCCTTTTCTTCCTTTTCATCTTCTTCCCCGGATGACTCTTCCTCGCTCTCACTGGAAGGCTTGTCCTCGTCACTGCTAGCCCCAAGTTTATCCATGTCCTCAAAATCACTCAAGTCACTTTCTTCAACATCATCGTCTTCCACAAACTCCCTCTTGCCGCTCTCTTCATCATCTTCCTCTTCTTCATCAGATGACTCGGAGGCGCTTGCCTCGTCCTGCTGTTCCAGTGCTTTATCAAAAGCTTGGATGGGAAAGTTATAAATATCCCCATACGCTCCCTGTTTGAGCCGCTCCAGTAATTCCTTCTCTATGGCATTGTCCAGCTGGGCCGCCACCAGGGCCTTTTCCTCTCTCCGCTTTTCCCTCCTTTCCACCTTCCTGCTCAGGGGAACCAGTTTGCGTTGCCTCTTGAGAGTGAGCTTGCGGATGCGGATCAAGTACTGTGTGATTTTTGTGAACCTCTGCTTGCACTTGTGTCTGATAAAGCGCGGCCAATAGATTAGGTTCTCGTCAAATTTGTTCCGAGCCTGCTCATAATTCTTGCTCAGTCCTACCCCCCTCCACCTCCGAGCCTGGGGAAGGCCGCTCTCTCCAATGGTCCTTCAATACCAAATAACAAAAAGCCCTTTTCCTCCTTCCTTT
Full Trace Sequence: TGCCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTCACTTTGGCTTTCTGCTGTGGCTCAGTTTCTTGTTCATACTCTATCTCCACATGCGGACGTTTCCTGATTAAATGTCCTTTCAGTGGGGCCTTGCCCTTCGACTTTGCTTTGGGGGCCTTTTCTTCCTTTTCATCTTCTTCCCCGGATGACTCTTCCTCGCTCTCACTGGAAGGCTTGTCCTCGTCACTGCTAGCCCCAAGTTTATCCATGTCCTCAAAATCACTCAAGTCACTTTCTTCAACATCATCGTCTTCCACAAACTCCCTCTTGCCGCTCTCTTCATCATCTTCCTCTTCTTCATCAGATGACTCGGAGGCGCTTGCCTCGTCCTGCTGTTCCAGTGCTTTATCAAAAGCTTGGATGGGAAAGTTATAAATATCCCCATACGCTCCCTGTTTGAGCCGCTCCAGTAATTCCTTCTCTATGGCATTGTCCAGCTGGGCCGCCACCAGGGCCTTTTCCTCTCTCCGCTTTTCCCTCCTTTCCACCTTCCTGCTCAGGGGAACCAGTTTGCGTTGCCTCTTGAGAGTGAGCTTGCGGATGCGGATCAAGTACTGTGTGATTTTTGTGAACCTCTGCTTGCACTTGTGTCTGATAAAGCGCGGCCAATAGATTAGGTTCTCGTCAAATTTGTTCCGAGCCTGCTCATAATTCTTGCTCAGTCCTACCCCCCTCCACCTCCGAGCCTGGGGAAGGCCGCTCTCTCCAATGGTCCTTCAATACCAAATAACAAAAAGCCCTTTTCCTCCTTCCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTCACTTTGGCTTTCTGCT