ORFeome > map1lc3c ORF1 – XORFeome v1.0

map1lc3c ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: map1lc3c
Gene ID: 6252465
Gene Page ID: 1003532
ORF Xenbase ID: 17283069

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123362
Original XGC clone length: 375

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ837507
dbEST ID: 79655209
Trimmed Sequence: ATGCAGTCTAACCAAAAAATGTCTCAGCCGTTTAAGCAGAGAAAGAGTCTGGCATCCAGAAAAGAAGAAGTCATTGGAATAAAGGCAAAATTTCCAACAAAAATCCCGGTGATTGTTGAAAGATACCGCAGAGAAAAATATCTACCCCTTTTGGACAAAACAAAATTTCTTGTTCCCAAGGACCTCTCTATGATGCAATTTATAAATATTATTAGAAATCGCATGAACTTATCTGCTACACAGGCATTCTACCTACTTGTGAACAACAAGAGCCTTGCCAGTATGTCTCTTACAATGGCTGAACTTTATAAGGACCATAAGGATGAAGACGGGTTCCTATATATGACATATGCATCTCAAGAAATGTTTGGTTT
Full Trace Sequence: GAGGGCCCATATAATGGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGTCTAACCAAAAAATGTCTCAGCCGTTTAAGCAGAGAAAGAGTCTGGCATCCAGAAAAGAAGAAGTCATTGGAATAAAGGCAAAATTTCCAACAAAAATCCCGGTGATTGTTGAAAGATACCGCAGAGAAAAATATCTACCCCTTTTGGACAAAACAAAATTTCTTGTTCCCAAGGACCTCTCTATGATGCAATTTATAAATATTATTAGAAATCGCATGAACTTATCTGCTACACAGGCATTCTACCTACTTGTGAACAACAAGAGCCTTGCCAGTATGTCTCTTACAATGGCTGAACTTTATAAGGACCATAAGGATGAAGACGGGTTCCTATATATGACATATGCATCTCAAGAAATGTTTGGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCAATGGAAAGATAACTCAAACAATCTAAATTTACACTTCCGTGGGCGGCCGGGGGGCNTGGCTTCGCCCCGCGTGCGAACAAAGAAAGGGGGGGGGGGCATAACTTGTGGTTGTCGATGGAGGGACCCCGCTGGAAGAAAAAACTTCGGCTCCGAGTTTGTATGGAAGGTAGGGAGCGCCGCGCGGCACGAGGGGCGGAAAAAAAAAACAAAAAAAAAAAGAGAAAAAAAAAAAAAGAGGGGAATTTCTTGTCTGGGGTTGTAGGGGTTATATTTATGGTAAGAAGACATACCAACCCAGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGTCTAACCAAAAAATGTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837506
dbEST ID: 79655208
Trimmed Sequence: ACCAAACATTTCTTGAGATGCATATGTCATATATAGGAACCCGTCTTCATCCTTATGGTCCTTATAAAGTTCAGCCATTGTAAGAGACATACTGGCAAGGCTCTTGTTGTTCACAAGTAGGTAGAATGCCTGTGTAGCAGATAAGTTCATGCGATTTCTAATAATATTTATAAATTGCATCATAGAGAGGTCCTTGGGAACAAGAAATTTTGTTTTGTCCAAAAGGGGTAGATATTTTTCTCTGCGGTATCTTTCAACAATCACCGGGATTTTTGTTGGAAATTTTGCCTTTATTCCAATGACTTCTTCTTTTCTGGATGCCAGACTCTTTCTCTGCTTAAACGGCTGAGACATTTTTTGGTTAGACTGCATGG
Full Trace Sequence: GGGGAATCTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCAAACATTTCTTGAGATGCATATGTCATATATAGGAACCCGTCTTCATCCTTATGGTCCTTATAAAGTTCAGCCATTGTAAGAGACATACTGGCAAGGCTCTTGTTGTTCACAAGTAGGTAGAATGCCTGTGTAGCAGATAAGTTCATGCGATTTCTAATAATATTTATAAATTGCATCATAGAGAGGTCCTTGGGAACAAGAAATTTTGTTTTGTCCAAAAGGGGTAGATATTTTTCTCTGCGGTATCTTTCAACAATCACCGGGATTTTTGTTGGAAATTTTGCCTTTATTCCAATGACTTCTTCTTTTCTGGATGCCAGACTCTTTCTCTGCTTAAACGGCTGAGACATTTTTTGGTTAGACTGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAATCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGCCCGAACCATGAGAAAAAAGATAGTATACAACATGCTAACTTAGGGCAGCCCGAGGATAAAACACACATAAGGTCTACCGAAGAAGAAGAAAAAGCGTACATGGAATTGGGTGAGGCCCAACCCAAGGGAAAAACGCGGCGGGGGCAAACTGAATGATGAACCCAAGGGCTACAGGGCGGGCGGCAATCTTACTGATAGTTGGGTGGGGCGGCCCCAGGGGCTATTGGGGGGTGGTAAAAAAGAAATAAAAAAAAAAAAGAAGAAAAATTAGGAGGGGTAATC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCAAACATTTCTTGAGATGCATA