ORFeome > map2k1 ORF1 – XORFeome v1.0

map2k1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: map2k1
Gene ID: 865216
Gene Page ID: 478821
ORF Xenbase ID: 17283081

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043913
Original XGC clone length: 1188

Human orthology & disease relationships

NCBI Entrez ID: 5604
Ensembl gene IDs: ENSG00000169032
Directly associated (OMIM) disease MIM numbers: 615279
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,114480,114500,115150,125853,148700,162210,180849,193520,218040,246200,262190,268000,300291,300301,300436,300558,300584,303600,308300,601859,604370,605027,607271,607785,608203,609942,609968

Library Location

Plate ID: GDExl11014
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ824138
dbEST ID: 79641840
Trimmed Sequence: ATGCCTAAAAAGAAGCCTACGCCCATACAGCTGAATCCCAACCCCGAAGGGACTGCTGTGAACGGGACCCCTACAGCCGAGACAAACCTTGAAGCTCTGCAGAAAAAGTTGGAAGAGCTTGAGCTGGATGAGCAGCAGAGGAAGCGTCTGGAGGCTTTTCTCACCCAGAAGCAGAAAGTTGGGGAACTGAAGGATGACGACTTTGAAAAAGTTTCAGAGCTTGGAGCAGGCAACGGAGGAGTGGTGTTTAAGGTGTCCCACAAGCCAACCAGCTTGATTATGGCCAGGAAGTTGATTCATCTGGAGATTAAGCCTGCAATCCGAAACCAGATTATCCGAGAGTTGCAGGTTCTGCATGAATGTAACTCCCCATACATTGTGGGGTTCTATGGGGCCTTCTACAGTGATGGAGAGATCAGCATTTGCATGGAACACATGGATGGAGGCTCCCTTGATCAGGTTCTGAAGAAAGCTGGCAAAATCCCAGAAAAGATTTTGGGAAAAGTCAGCATTGCAGTGATAAAAGGTCTAACCTACCTGAGAGAAAAGCATAAGATAATGCACAGAGATGTGAAACCTTCTAACATCCTGGTCAACTCTAGAGGAGAGATAAAACTCTGCGACTTTGGGGTCAGCGGGCACTCATAGACTCCATGGCAAATTCTTTGTTGGGGACAGATCCTATATGTCACCGGAGCGACTACAGGCACTCATTTATCTGTGCAATCAGACATCTGAAGCAGGGGGCTGTTCCCTGGGGGGATGGGGCCATTTGGAAGGGATCCCCATTCCCCCCCCCGAGGCCAAAAAACGGGAAATTATTTTTTTGGGGGTTTTTTT
Full Trace Sequence: CAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTAAAAAGAAGCCTACGCCCATACAGCTGAATCCCAACCCCGAAGGGACTGCTGTGAACGGGACCCCTACAGCCGAGACAAACCTTGAAGCTCTGCAGAAAAAGTTGGAAGAGCTTGAGCTGGATGAGCAGCAGAGGAAGCGTCTGGAGGCTTTTCTCACCCAGAAGCAGAAAGTTGGGGAACTGAAGGATGACGACTTTGAAAAAGTTTCAGAGCTTGGAGCAGGCAACGGAGGAGTGGTGTTTAAGGTGTCCCACAAGCCAACCAGCTTGATTATGGCCAGGAAGTTGATTCATCTGGAGATTAAGCCTGCAATCCGAAACCAGATTATCCGAGAGTTGCAGGTTCTGCATGAATGTAACTCCCCATACATTGTGGGGTTCTATGGGGCCTTCTACAGTGATGGAGAGATCAGCATTTGCATGGAACACATGGATGGAGGCTCCCTTGATCAGGTTCTGAAGAAAGCTGGCAAAATCCCAGAAAAGATTTTGGGAAAAGTCAGCATTGCAGTGATAAAAGGTCTAACCTACCTGAGAGAAAAGCATAAGATAATGCACAGAGATGTGAAACCTTCTAACATCCTGGTCAACTCTAGAGGAGAGATAAAACTCTGCGACTTTGGGGTCAGCGGGCACTCATAGACTCCATGGCAAATTCTTTGTTGGGGACAGATCCTATATGTCACCGGAGCGACTACAGGCACTCATTTATCTGTGCAATCAGACATCTGAAGCAGGGGGCTGTTCCCTGGGGGGATGGGGCCATTTGGAAGGGATCCCCATTCCCCCCCCCGAGGCCAAAAAACGGGAAATTATTTTTTTGGGGGTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTAAAAAGAAGCCTACGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ829445
dbEST ID: 79647147
Trimmed Sequence: CACTCCGGCGGCATGGGTTGGGGTACTGGGCTGCTTAAGGCCCATAGTGGAACAGAGCCATCCAGCAAAATCCACTTCCTCCAACTCTGACTGCTTAATGAAGCTGTGAACCATTAGCTGTTTAAGGTCTGCTCTCTCTGCCGGATTCTTCACAAGACATTTATTCACAAAGTCCTGGAACTCAGCTCCAAATACTCCACTGGGCAATTTTGGAGGCGGCTCGTTCACGATATAATCCAGAAGTTCAAAAATAGCCATGGGTGGTCGACTATCAGGACCGTATGAGCTTATTGGACGTCCGGGTGGCCGGGGGCGAGGTGCCAGTTCAGAAGATGCTGGATCCCTTTCTACAGAACACCCAAAGATAAGTTCCAGCTCTTTGGCATCAGGGGGTGGAATGGGATACCTTCCAATGGCCATTTCCACCAGCGACAGCCCCATGCTCCAGATGTCTGATTGCACAGAATAATGAGTGCCCTGTAGTCGCTCCGGTGACATATAGGATCTTGTCCCAACAAAGGAATTTGCCATGGAGTCTATGAGTTGCCCGCTGACCCCAAAGTCGCAGAGTTTTATCTCTCCTCTAGAGTTGACCAGGATGTTAAAGGGTTCACATCTCTGTGCATTATCTTATGCTTTTCCTCTCAGTAAGGTAAACCTTTTTATCACTGCAAGCTGAATTTTTCCCAAAATCTTTTTCTTGGAATTTTTCCCAACCTTTTCTTTCGAAACCGGGGAACAAGGGAAAACCCTCCCCACCCCG
Full Trace Sequence: GGACGAGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACTCCGGCGGCATGGGTTGGGGTACTGGGCTGCTTAAGGCCCATAGTGGAACAGAGCCATCCAGCAAAATCCACTTCCTCCAACTCTGACTGCTTAATGAAGCTGTGAACCATTAGCTGTTTAAGGTCTGCTCTCTCTGCCGGATTCTTCACAAGACATTTATTCACAAAGTCCTGGAACTCAGCTCCAAATACTCCACTGGGCAATTTTGGAGGCGGCTCGTTCACGATATAATCCAGAAGTTCAAAAATAGCCATGGGTGGTCGACTATCAGGACCGTATGAGCTTATTGGACGTCCGGGTGGCCGGGGGCGAGGTGCCAGTTCAGAAGATGCTGGATCCCTTTCTACAGAACACCCAAAGATAAGTTCCAGCTCTTTGGCATCAGGGGGTGGAATGGGATACCTTCCAATGGCCATTTCCACCAGCGACAGCCCCATGCTCCAGATGTCTGATTGCACAGAATAATGAGTGCCCTGTAGTCGCTCCGGTGACATATAGGATCTTGTCCCAACAAAGGAATTTGCCATGGAGTCTATGAGTTGCCCGCTGACCCCAAAGTCGCAGAGTTTTATCTCTCCTCTAGAGTTGACCAGGATGTTAAAGGGTTCACATCTCTGTGCATTATCTTATGCTTTTCCTCTCAGTAAGGTAAACCTTTTTATCACTGCAAGCTGAATTTTTCCCAAAATCTTTTTCTTGGAATTTTTCCCAACCTTTTCTTTCGAAACCGGGGAACAAGGGAAAACCCTCCCCACCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTCCGGCGGCATGGGTT