ORFeome > mapk14 ORF1 – XORFeome v1.0

mapk14 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mapk14
Gene ID: 1018624
Gene Page ID: 1018616
ORF Xenbase ID: 17283135

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC056064
Original XGC clone length: 1086

Human orthology & disease relationships

NCBI Entrez ID: 1432
Ensembl gene IDs: ENSG00000112062
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,109800,124200,133239,151623,211980,228600,236490,259500,260500,275355,300291,300301,300367,300584,308300,600072,603218

Library Location

Plate ID: GDExl11019
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ824588
dbEST ID: 79642290
Trimmed Sequence: ATGTCATCCAATCAATCTTACGTCTTCTACAGACAAGAACTAAACAAAACATTGTGGGAGGTGCCTGATAGGTACCAAAACCTGACACCAGTGGGTTCTGGGGCCTACGGTTCCGTGTGCTCATCATTTGACACTAGGACAGCATTGCGTATTGCTGTAAAAAAACTCTCTAGGCCGTTTCAGTCCATCATTCATGCCAAGCGAACATATAGAGAACTCCGTCTGCTTAAGCATATGAAACATGAAAATGTCATTGGACTCCTAGATGTTTTCTCACCTGCAAAATCATTTGAGGAATTCAATGATGTATATCTTGTTACACATCTAATGGGAGCTGATCTCAATAATATTGTTAAGTGTCAAAAGCTTACAGATGACCATGTACAGTTTCTTATCTATCAAATCTTGCGTGGCTTGAAGTATATTCATTCTGCAGGCATTATCCACAGAGACCTAAAACCTAGCAATCTTGCAGTGAATGAAGACTGTGAGTTAAAGATTCTTGATTTTGGTTTGGCACGGCATACAGATGAGGAAATGACTGGATATGTTGCTACTCGCTGGTACAGAGCACCAGAAATCATGCTGAATTGGATGCATTACAATCAGACAGTTGACANTCTGGTCGGTGGGCTGCATAATGGCAGAGCTTCTCACAGGAAGGACCTTGTTTCCAGGCACAGACCATATTGATCATTTGAAGCTAATTTTTGAGACTAGGTCGGAACCCCGAAACAGAAGCTCTGCCGAAAATCTCTTCCGAAGGCGGCTCGAACTTACCTACAGTCCTTGCCTAAAGCCCAAAAAAAAAATTTTTTGGAAAGTTTTTCTTTGGGCCCACCCCCCAACCCTTAA
Full Trace Sequence: TTTTTCGACTTGGATAGTGACCTAGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCATCCAATCAATCTTACGTCTTCTACAGACAAGAACTAAACAAAACATTGTGGGAGGTGCCTGATAGGTACCAAAACCTGACACCAGTGGGTTCTGGGGCCTACGGTTCCGTGTGCTCATCATTTGACACTAGGACAGCATTGCGTATTGCTGTAAAAAAACTCTCTAGGCCGTTTCAGTCCATCATTCATGCCAAGCGAACATATAGAGAACTCCGTCTGCTTAAGCATATGAAACATGAAAATGTCATTGGACTCCTAGATGTTTTCTCACCTGCAAAATCATTTGAGGAATTCAATGATGTATATCTTGTTACACATCTAATGGGAGCTGATCTCAATAATATTGTTAAGTGTCAAAAGCTTACAGATGACCATGTACAGTTTCTTATCTATCAAATCTTGCGTGGCTTGAAGTATATTCATTCTGCAGGCATTATCCACAGAGACCTAAAACCTAGCAATCTTGCAGTGAATGAAGACTGTGAGTTAAAGATTCTTGATTTTGGTTTGGCACGGCATACAGATGAGGAAATGACTGGATATGTTGCTACTCGCTGGTACAGAGCACCAGAAATCATGCTGAATTGGATGCATTACAATCAGACAGTTGACANTCTGGTCGGTGGGCTGCATAATGGCAGAGCTTCTCACAGGAAGGACCTTGTTTCCAGGCACAGACCATATTGATCATTTGAAGCTAATTTTTGAGACTAGGTCGGAACCCCGAAACAGAAGCTCTGCCGAAAATCTCTTCCGAAGGCGGCTCGAACTTACCTACAGTCCTTGCCTAAAGCCCAAAAAAAAAATTTTTTGGAAAGTTTTTCTTTGGGCCCACCCCCCAACCCTTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCATCCAATCAATCTTACGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ829939
dbEST ID: 79647641
Trimmed Sequence: AGATTCCATCTCTTCAGAGTCCAAGGGAGGAGGCACAAAGCAGGTCACTTCCTCATAGGTTAGACGTTTCCACTCTTCTATGTCCAACTCACGACTCTCAAAGCTCTGATCATAAGGCTCAGCTATCGGCTCATCATCAGGGTCATGGTACTGAGCAAAATAAGAGTGTGCTAGAGCCTCTGCTGCTGTAATCCGCTTGTCTGTATCCAAAACCAACATTTTCTCCAGTAAATCTACAGCTTGTGGATTGGCGCCTAGAAAAACATCCTCAAAATTCATCTTTGGCATATATGGCAAGGACTGTATGTAGTTACGAGCAGCCTCCGAAGAGATTTTCTGCAGGAGCTCTGGTTCTGGGGTTCCGACCAGTCTCAAAATTAGCTTCAATTGATCAATATGGTCTGTGCCTGGAAACAAGGTCCTTCCTGTGAGAAGCTCTGCCATTATGCAGCCCACCGACCAGATGTCAACTGTCTGATTGTAATGCATCCAATTCAGCATGATTTCTGGTGCTCTGTACCAGCGAGTAGCAACATATCCAGTCATTTCCTCATCTGTATGCCGTGCCAAACCAAAATCAAGAATCTTTAACTCACAGTCTTCATTCACTGNCAGATTGCTAGGTTTTAGGTCTCTGTGGGATATGCCTGCAGAATGAATATACTTCAAGCCCACGCAAGATTTGATAGATAAGAAAACTGTACCTGGGTCCATCTGTTAGCCTTTTGGAACCTTAACAAATAATATTTAAAAATAACCCCCCCCCTTTAAAAGGTGTA
Full Trace Sequence: ACGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGATTCCATCTCTTCAGAGTCCAAGGGAGGAGGCACAAAGCAGGTCACTTCCTCATAGGTTAGACGTTTCCACTCTTCTATGTCCAACTCACGACTCTCAAAGCTCTGATCATAAGGCTCAGCTATCGGCTCATCATCAGGGTCATGGTACTGAGCAAAATAAGAGTGTGCTAGAGCCTCTGCTGCTGTAATCCGCTTGTCTGTATCCAAAACCAACATTTTCTCCAGTAAATCTACAGCTTGTGGATTGGCGCCTAGAAAAACATCCTCAAAATTCATCTTTGGCATATATGGCAAGGACTGTATGTAGTTACGAGCAGCCTCCGAAGAGATTTTCTGCAGGAGCTCTGGTTCTGGGGTTCCGACCAGTCTCAAAATTAGCTTCAATTGATCAATATGGTCTGTGCCTGGAAACAAGGTCCTTCCTGTGAGAAGCTCTGCCATTATGCAGCCCACCGACCAGATGTCAACTGTCTGATTGTAATGCATCCAATTCAGCATGATTTCTGGTGCTCTGTACCAGCGAGTAGCAACATATCCAGTCATTTCCTCATCTGTATGCCGTGCCAAACCAAAATCAAGAATCTTTAACTCACAGTCTTCATTCACTGNCAGATTGCTAGGTTTTAGGTCTCTGTGGGATATGCCTGCAGAATGAATATACTTCAAGCCCACGCAAGATTTGATAGATAAGAAAACTGTACCTGGGTCCATCTGTTAGCCTTTTGGAACCTTAACAAATAATATTTAAAAATAACCCCCCCCCTTTAAAAGGTGTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGATTCCATCTCTTCAGAGTCCA