ORFeome > mapkapk3 ORF1 – XORFeome v1.0

mapkapk3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mapkapk3
Gene ID: 866582
Gene Page ID: 854887
ORF Xenbase ID: 17283177

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123161
Original XGC clone length: 909

Human orthology & disease relationships

NCBI Entrez ID: 7867
Ensembl gene IDs: ENSG00000114738
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 215600,604219,606595

Library Location

Plate ID: GDExl11087
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ838145
dbEST ID: 79655847
Trimmed Sequence: ATGGAGGAGAATGCCAATGTACAGGAGACGGGGGACCAGGAAACCCTCCCACCAGCCCAACCTGTTAAGCAGGAGATTAAGCGACATGCCATCACTGATGATTACAAAGTGTCAAAGCAGGTGCTGGGCCTGGGTATCAATGGCAAAGTGTTGGAATGTTACCGCAGGGATACCGGGCAGAAGTGTGCACTCAAGATCCTATATGATAGCCCCAAAGCTCGACGAGAGGTGGAGTGTCACATTAGAGCATCTGGAGGACCACACATTGTACATGTGCTAGATGTGTATGAAAACATACATCGCTCAAAGAGATGCTTGCTCATCGTCATGGACTGCATGCAGGGTGGGGAGCTGTTCACTCGCATCCAGAAGAGAGGCGACCAAGCGTTCACTGAAAGAGAGGCTTCAGAGATCATGCGGGACATAAGAATGGCCATACAGCATCTCCATGGAATGAATATCGCTCACAGGGATGTTAAGCCAGAAAATCTCCTCTACACCAGCAAGGAGAGCAATGCAGAGCTGAAGATCACAGATTTTGGCTTTTCCAAAGAAACAACACTTCAAAATGCGCTCCAGACTCCATGCTATACGCCGTATTATGTGGCCCCTGAAATGTTGGGCCCGAAAAGTATGATAAATATGCAAACTGTGGTCACTGGGAGTCATCATGTATATTCTTCTTCTTTGGTATCCTGGTTTTCTATTCTACACAAGTCAGGCCATCTCCTCGGGGAATGAAAAAAGGAAACACAAGGGGAAGGT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGAGAATGCCAATGTACAGGAGACGGGGGACCAGGAAACCCTCCCACCAGCCCAACCTGTTAAGCAGGAGATTAAGCGACATGCCATCACTGATGATTACAAAGTGTCAAAGCAGGTGCTGGGCCTGGGTATCAATGGCAAAGTGTTGGAATGTTACCGCAGGGATACCGGGCAGAAGTGTGCACTCAAGATCCTATATGATAGCCCCAAAGCTCGACGAGAGGTGGAGTGTCACATTAGAGCATCTGGAGGACCACACATTGTACATGTGCTAGATGTGTATGAAAACATACATCGCTCAAAGAGATGCTTGCTCATCGTCATGGACTGCATGCAGGGTGGGGAGCTGTTCACTCGCATCCAGAAGAGAGGCGACCAAGCGTTCACTGAAAGAGAGGCTTCAGAGATCATGCGGGACATAAGAATGGCCATACAGCATCTCCATGGAATGAATATCGCTCACAGGGATGTTAAGCCAGAAAATCTCCTCTACACCAGCAAGGAGAGCAATGCAGAGCTGAAGATCACAGATTTTGGCTTTTCCAAAGAAACAACACTTCAAAATGCGCTCCAGACTCCATGCTATACGCCGTATTATGTGGCCCCTGAAATGTTGGGCCCGAAAAGTATGATAAATATGCAAACTGTGGTCACTGGGAGTCATCATGTATATTCTTCTTCTTTGGTATCCTGGTTTTCTATTCTACACAAGTCAGGCCATCTCCTCGGGGAATGAAAAAAGGAAACACAAGGGGAAGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGAGAATGCCAATGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838144
dbEST ID: 79655846
Trimmed Sequence: AGTTGAACATACATTTATCCATGGATGGTTCATGAACTGGGTAATAGACATCCTCTCAGATGGGTCAGTCTTCAGCAAGTGTTGGATCATCTGCTTGGCTTCCTCTGACACATCATTCCACTCAGGTGCTGGAAACTCATACTGTCCCATGCGGATCCGTTTTTTCATTCCCGGGGAGATGGCCTGACCTGTGTTAGAATAGAAAGGAGGATACCCACAGAGAAGTATATACATGATGACTCCCAGTGACCACATGTCGCATGATTTATCATACTTTTCTGGGCCCAACACTTCAGGGGCCACATAATACGGCGTATAGCATGGAGTCTGGAGCGCATTTTGAACTGTTGTTTCTTTGGAAAAGCCAAAATCTGTGATCTTCAGCTCTGCATTGCTCTCCTTGCTGGTGTAGAGGAGATTTTCTGGCTTAGCATCCCTGTGAGCGATATTCATTCCATGGAGATGCTGTATGGCCATTCCTATGTCCCGCATGATCTCTGAAGCCTCTCTTTCAGTGAACGCTTGGTCGCCTCTCTTCTGGATGCGAGTGAACAGCTCCCCACCCTGCATGCAGTCCCTGACGATGAACAAACATCTCTTTGAGCGATGTATGTTTTCATTACCCATCTACAAATGTTACAATGTGTGTTCCCTCCGAAGCCTCTAATTGTGACACTCCCACCTCCTCTTCAAGCCTTTGGGGGCTATTAATATAGGAACCCTTGAATTGCCCAACTTTCCTCTCCCCGGCTATCCCCTTGCG
Full Trace Sequence: GGGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGTTGAACATACATTTATCCATGGATGGTTCATGAACTGGGTAATAGACATCCTCTCAGATGGGTCAGTCTTCAGCAAGTGTTGGATCATCTGCTTGGCTTCCTCTGACACATCATTCCACTCAGGTGCTGGAAACTCATACTGTCCCATGCGGATCCGTTTTTTCATTCCCGGGGAGATGGCCTGACCTGTGTTAGAATAGAAAGGAGGATACCCACAGAGAAGTATATACATGATGACTCCCAGTGACCACATGTCGCATGATTTATCATACTTTTCTGGGCCCAACACTTCAGGGGCCACATAATACGGCGTATAGCATGGAGTCTGGAGCGCATTTTGAACTGTTGTTTCTTTGGAAAAGCCAAAATCTGTGATCTTCAGCTCTGCATTGCTCTCCTTGCTGGTGTAGAGGAGATTTTCTGGCTTAGCATCCCTGTGAGCGATATTCATTCCATGGAGATGCTGTATGGCCATTCCTATGTCCCGCATGATCTCTGAAGCCTCTCTTTCAGTGAACGCTTGGTCGCCTCTCTTCTGGATGCGAGTGAACAGCTCCCCACCCTGCATGCAGTCCCTGACGATGAACAAACATCTCTTTGAGCGATGTATGTTTTCATTACCCATCTACAAATGTTACAATGTGTGTTCCCTCCGAAGCCTCTAATTGTGACACTCCCACCTCCTCTTCAAGCCTTTGGGGGCTATTAATATAGGAACCCTTGAATTGCCCAACTTTCCTCTCCCCGGCTATCCCCTTGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGTTGAACATACATTTATCCATGG