ORFeome > marc1 ORF1 – XORFeome v1.0

marc1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: 36951
Gene ID: 5823412
Gene Page ID: 5823410
ORF Xenbase ID: 17283219

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084850
Original XGC clone length: 1032

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ839970
dbEST ID: 79657672
Trimmed Sequence: ATGTCCAACACAGTCTTTTCTGGTGCAGTTGGGCCACTGAGAGCCGCAGCTCTGTCTATATCTCGCCATCGCCTTCCCTTGCTCTGTGCCGCCGGCCTTGGGCTCACGGCTGTGGCTTCCTGGATGTGGTGGCGGAAACGACAAGGTGAGGCTGAGGATCTGCAACAGGTTGGCATCGTGTCTCAGCTTCTGATTTACCCAGTGAAGTCCTGCCGTGCCGTGCCTGTGCAGGAGGCTGAATGTTCTGCTCTAGGTCTGAAGAGTGGGCATCTTGAGGACAGACATTGGCTAGTAGTGACCGAGGAGGGGAACATGGTGACTGCCAGACAGGAGCCTAGGATGGTCCTCATCTCAGCAACTTTTTGTGGTAACACTTTGTGCCTTAATGGTCCAGAAATGCAGGAGGTTCAGATTCCATTGCCACTGCCCAAGAGTAATCGGGTGCTAGACTGCAGGGTATTTGGACAAGACATCCAGGGTAGAGACTCTGGTGAGCAGGCTTCTGAATGGCTGGCCACCTATTTCCAGAGCAGCCAACCCTACCGCTTAGTTCATTTTGAGGCTGATGTCATGCGACCACGACAGTCCAAGAAAAAGGAAAAGTTGTTCAGAGATAAAGACGTCATCGCTTACCCTGACGCCAGTCCCATCATGCTCTTATCAAAAACCTCCATGGAGGCTCTCAATAATCGCCTTTAACAACCCGTCCCCTTTGGCAAAACTTCCGAACATTGCATTGTGGCCACTTGGGGTGCAAGGCCCTTTGCCAAA
Full Trace Sequence: GGGGCCCAAATAATAGATGTTTATTTNTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCAACACAGTCTTTTCTGGTGCAGTTGGGCCACTGAGAGCCGCAGCTCTGTCTATATCTCGCCATCGCCTTCCCTTGCTCTGTGCCGCCGGCCTTGGGCTCACGGCTGTGGCTTCCTGGATGTGGTGGCGGAAACGACAAGGTGAGGCTGAGGATCTGCAACAGGTTGGCATCGTGTCTCAGCTTCTGATTTACCCAGTGAAGTCCTGCCGTGCCGTGCCTGTGCAGGAGGCTGAATGTTCTGCTCTAGGTCTGAAGAGTGGGCATCTTGAGGACAGACATTGGCTAGTAGTGACCGAGGAGGGGAACATGGTGACTGCCAGACAGGAGCCTAGGATGGTCCTCATCTCAGCAACTTTTTGTGGTAACACTTTGTGCCTTAATGGTCCAGAAATGCAGGAGGTTCAGATTCCATTGCCACTGCCCAAGAGTAATCGGGTGCTAGACTGCAGGGTATTTGGACAAGACATCCAGGGTAGAGACTCTGGTGAGCAGGCTTCTGAATGGCTGGCCACCTATTTCCAGAGCAGCCAACCCTACCGCTTAGTTCATTTTGAGGCTGATGTCATGCGACCACGACAGTCCAAGAAAAAGGAAAAGTTGTTCAGAGATAAAGACGTCATCGCTTACCCTGACGCCAGTCCCATCATGCTCTTATCAAAAACCTCCATGGAGGCTCTCAATAATCGCCTTTAACAACCCGTCCCCTTTGGCAAAACTTCCGAACATTGCATTGTGGCCACTTGGGGTGCAAGGCCCTTTGCCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCAACACAGTCTTTTCTGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839969
dbEST ID: 79657671
Trimmed Sequence: CCCCTTCCTGGTGACACGATACACTGGATCACCCACTCGTATTATGCCGGTCTGTTCCACACCATAATACTGGCCAAAGAGAGGAGCGTTCTTGTACACTTCTTTCAAGGAGGAGTCGCTCTGCCGAAAGGTTCTCAGGGTGTCAAGTGGCTCCTTGCGGGTAATAACTCCGCTGTTGGGATTGACAGTGGTCAAGACACATCGGCCACAAGCCATTACTCTCTTAAGCCTTGTGGCACCGAGCCTCACATCATCCCAGTCATCCTCTGCAAAGGCCTCGCACCCAGATGCCACAATGCATGGTCGGAAGTTTGCCAAAGAGACCGGCTGTTCAAGGCGACTATTGAGAGCCTCCATGGAGGTCTCTGATAAGAGCATGATGGGACTGGCGTCAGGGTAAGCGATGACGTCTTTATCTCTGAACAACTTTTCCTTTTTCTTGGACTGTCGTGGTCGCATGACATCAGCCTCAAAATGAACTAAGCGGTAGGGTTGGCTGCTCTGGAAATAGGTGGCCAGCCATTCAAAAGCCTGCTCACCAGAGTCTCTACCCTGGATGTCTTGTCCAAATACCCTGGAATCTAGCAACCGAATACTCTTGGGCAGTGGCAATGGAATCTGAACCTCCTGCATTTCCGGACCATTAAGGCACATAGTGTTAACCACAAAAAGTTGCCCGAAAATAAAGAACCTCCCCTAGGCTCCCGGTCCGGGCCGCTCACCCATGTTC
Full Trace Sequence: GAAGAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCCCTTCCTGGTGACACGATACACTGGATCACCCACTCGTATTATGCCGGTCTGTTCCACACCATAATACTGGCCAAAGAGAGGAGCGTTCTTGTACACTTCTTTCAAGGAGGAGTCGCTCTGCCGAAAGGTTCTCAGGGTGTCAAGTGGCTCCTTGCGGGTAATAACTCCGCTGTTGGGATTGACAGTGGTCAAGACACATCGGCCACAAGCCATTACTCTCTTAAGCCTTGTGGCACCGAGCCTCACATCATCCCAGTCATCCTCTGCAAAGGCCTCGCACCCAGATGCCACAATGCATGGTCGGAAGTTTGCCAAAGAGACCGGCTGTTCAAGGCGACTATTGAGAGCCTCCATGGAGGTCTCTGATAAGAGCATGATGGGACTGGCGTCAGGGTAAGCGATGACGTCTTTATCTCTGAACAACTTTTCCTTTTTCTTGGACTGTCGTGGTCGCATGACATCAGCCTCAAAATGAACTAAGCGGTAGGGTTGGCTGCTCTGGAAATAGGTGGCCAGCCATTCAAAAGCCTGCTCACCAGAGTCTCTACCCTGGATGTCTTGTCCAAATACCCTGGAATCTAGCAACCGAATACTCTTGGGCAGTGGCAATGGAATCTGAACCTCCTGCATTTCCGGACCATTAAGGCACATAGTGTTAACCACAAAAAGTTGCCCGAAAATAAAGAACCTCCCCTAGGCTCCCGGTCCGGGCCGCTCACCCATGTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCCCTTCCTGGTGACACGAT