ORFeome > march3 ORF1 – XORFeome v1.0

march3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: 37681
Gene ID: 866113
Gene Page ID: 491982
ORF Xenbase ID: 17283231

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123374
Original XGC clone length: 759

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ837487
dbEST ID: 79655189
Trimmed Sequence: ATGACAACCAGTCGCTGCAGTCACCTGCCTGAGGTCTTACCAGACTGCACGAGCTCGGCCCCTTCTGGAAAGACAGTGGAAGACTGTAGCAGTCTTGTGAATGGGCAGCCACAGTATGTCATGCAAGTTTCAGCAAAAGACGGTCAGCTGCTGTCAACTGTAGTGCGGACCCTCACAACCCAGAGCAGCTTCAATGACCATCCAATGTGCAGAATTTGCCATGAAGGAAGTACCCAAGAGGACCTCCTTTCTCCATGTGAATGCACAGGAACGTTAGGAACCATACACCGAAGCTGCCTGGAGCACTGGCTTTCCTCCTCTAACACCAGCTACTGTGAACTCTGTCACTTCAGGTTTTCTGTGGAGCGCAAACCTCGGCCCTTAGTAGAGTGGCTACGGAATCCAGGCCCCCAGCATGAGAAAAGGACACTGTTTGGAGACATGGTGTGTTTCCTCTTCATCACTCCACTCGCCACAATCTCTGGCTGGTTGTGTCTCCGTGGAGCCGTGGATCATCTGCACTTCAGCAGCCGACTCGAAGCAGTTGGACTTATTGCATTAACAGTTGCACTCTTTACTATTTACCTCTTCTGGACACTCGTGTCTTTCAGATACCACTGTAGATTATACAATGAATGGCGTCGGACCAATCAAAGGGTTATTTCTGGTGATCCCCAAATCAGCCCATTTTACCTTCAGCTCACCAGTCTCTGGTGGGGCCTCACT
Full Trace Sequence: TCGAGGGCCAAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAACCAGTCGCTGCAGTCACCTGCCTGAGGTCTTACCAGACTGCACGAGCTCGGCCCCTTCTGGAAAGACAGTGGAAGACTGTAGCAGTCTTGTGAATGGGCAGCCACAGTATGTCATGCAAGTTTCAGCAAAAGACGGTCAGCTGCTGTCAACTGTAGTGCGGACCCTCACAACCCAGAGCAGCTTCAATGACCATCCAATGTGCAGAATTTGCCATGAAGGAAGTACCCAAGAGGACCTCCTTTCTCCATGTGAATGCACAGGAACGTTAGGAACCATACACCGAAGCTGCCTGGAGCACTGGCTTTCCTCCTCTAACACCAGCTACTGTGAACTCTGTCACTTCAGGTTTTCTGTGGAGCGCAAACCTCGGCCCTTAGTAGAGTGGCTACGGAATCCAGGCCCCCAGCATGAGAAAAGGACACTGTTTGGAGACATGGTGTGTTTCCTCTTCATCACTCCACTCGCCACAATCTCTGGCTGGTTGTGTCTCCGTGGAGCCGTGGATCATCTGCACTTCAGCAGCCGACTCGAAGCAGTTGGACTTATTGCATTAACAGTTGCACTCTTTACTATTTACCTCTTCTGGACACTCGTGTCTTTCAGATACCACTGTAGATTATACAATGAATGGCGTCGGACCAATCAAAGGGTTATTTCTGGTGATCCCCAAATCAGCCCATTTTACCTTCAGCTCACCAGTCTCTGGTGGGGCCTCACT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAACCAGTCGCTGC

Sequences - 3ʹ (reverse) EST

Accession: JZ837486
dbEST ID: 79655188
Trimmed Sequence: CACTATGGTTTCTTTCGAGTTCCTTTTGAACGAGTGAAGGCCCAACAGAGACTGCTGAGCTGAAGGTAAATTGGCTGATTTGGGGATCACCAGAATAACCCTTTGATTGGTCCGACGCCATTCATTGTATAATCTACAGTGGTATCTGAAAGACACGAGTGTCCAGAAGAGGTAAATAGTAAAGAGTGCAACTGTTAATGCAATAAGTCCAACTGCTTCGAGTCGGCTGCTGAAGTGCAGATGATCCACGGCTCCACGGAGACACAACCAGCCAGAGATTGTGGCGAGTGGAGTGATGAAGAGGAAACACACCATGTCTCCAAACAGTGTCCTTTTCTCATGCTGGGGGCCTGGATTCCGTAGCCACTCTACTAAGGGCCGAGGTTTGCGCTCCACAGAAAACCTGAAGTGACAGAGTTCACAGTAGCTGGTGTTAGAGGAGGAAAGCCAGTGCTCCAGGCAGCTTCGGTGTATGGTTCCTAACGTTCCTGTGCATTCACATGGAGAAAGGAGGTCCTCTTGGGTACTTCCCTTCATGGCAATTCTGCACATTTGATGGGTCTTGGGAGCTGCTCTGGGGTTGTGAGGGTCCGCACTACCGTTTAACAGCAACTGGACCGTCTTTTGCTGGAACCTGCATGGAATAACTTGGGGCTGCCCCTTTCACAGGAATGCCTAACATCCTTCCCCTGGGTTTTCCACAAAAGGGGGCCCAACCTCCGGGGCGGGCGTGGGATAAAACCCACCAAGGCAAGGGTAAAACTACA
Full Trace Sequence: CGGGAATCTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACTATGGTTTCTTTCGAGTTCCTTTTGAACGAGTGAAGGCCCAACAGAGACTGCTGAGCTGAAGGTAAATTGGCTGATTTGGGGATCACCAGAATAACCCTTTGATTGGTCCGACGCCATTCATTGTATAATCTACAGTGGTATCTGAAAGACACGAGTGTCCAGAAGAGGTAAATAGTAAAGAGTGCAACTGTTAATGCAATAAGTCCAACTGCTTCGAGTCGGCTGCTGAAGTGCAGATGATCCACGGCTCCACGGAGACACAACCAGCCAGAGATTGTGGCGAGTGGAGTGATGAAGAGGAAACACACCATGTCTCCAAACAGTGTCCTTTTCTCATGCTGGGGGCCTGGATTCCGTAGCCACTCTACTAAGGGCCGAGGTTTGCGCTCCACAGAAAACCTGAAGTGACAGAGTTCACAGTAGCTGGTGTTAGAGGAGGAAAGCCAGTGCTCCAGGCAGCTTCGGTGTATGGTTCCTAACGTTCCTGTGCATTCACATGGAGAAAGGAGGTCCTCTTGGGTACTTCCCTTCATGGCAATTCTGCACATTTGATGGGTCTTGGGAGCTGCTCTGGGGTTGTGAGGGTCCGCACTACCGTTTAACAGCAACTGGACCGTCTTTTGCTGGAACCTGCATGGAATAACTTGGGGCTGCCCCTTTCACAGGAATGCCTAACATCCTTCCCCTGGGTTTTCCACAAAAGGGGGCCCAACCTCCGGGGCGGGCGTGGGATAAAACCCACCAAGGCAAGGGTAAAACTACA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTATGGTTTCTTTCGAGTTC