ORFeome > march3 ORF1 – XORFeome v1.0

march3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6466587
Gene Page ID:
ORF Xenbase ID: 17254131

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC122490
Original XGC clone length: 447

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: JZ838331
dbEST ID: 79656033
Trimmed Sequence: ATGCAGCTGACGGTGAAAGCATTGAAAGGAAAAGAGGCCCATATTCAGGTCTCGGAAGGGGACACAGTCCTAGCAGTGAAACGACTAGTGGAAGAAAAGCTGCAAGTGCCGGTGTCACAGCAACGTTTGTTATTCAGAGGCAAATCCTTAGCAGATGAGCATTGCCTCTCCCATTACTCTATCGGTCCTGGATCAAGGCTAAACCTCATGGTGAAAGATCAAGTGGCTCCAGAGGGCCACAGTGGGAATAATACAGCATGGAAATCTCTGAGTGTAATCTTGAGGAAGCATTTCAGCCCAGCTGATGCAGAGAGAGTGCTGGAATATGTACAGAAGGACTATGAACGTAGTTTATCCCTTCTCAGCCTGGATGATATAGAACGGCTAGCAACGCGGATTCTACACCCACAGTATTCAGAAGCCGCAGACCTTGGCTTCCTGGACTT
Full Trace Sequence: GGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGCTGACGGTGAAAGCATTGAAAGGAAAAGAGGCCCATATTCAGGTCTCGGAAGGGGACACAGTCCTAGCAGTGAAACGACTAGTGGAAGAAAAGCTGCAAGTGCCGGTGTCACAGCAACGTTTGTTATTCAGAGGCAAATCCTTAGCAGATGAGCATTGCCTCTCCCATTACTCTATCGGTCCTGGATCAAGGCTAAACCTCATGGTGAAAGATCAAGTGGCTCCAGAGGGCCACAGTGGGAATAATACAGCATGGAAATCTCTGAGTGTAATCTTGAGGAAGCATTTCAGCCCAGCTGATGCAGAGAGAGTGCTGGAATATGTACAGAAGGACTATGAACGTAGTTTATCCCTTCTCAGCCTGGATGATATAGAACGGCTAGCAACGCGGATTCTACACCCACAGTATTCAGAAGCCGCAGACCTTGGCTTCCTGGACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCCTAAAAAATAAATAGAAACTCTAGCTCGTGTCTCAATCCTTGGAACCGTCAGAGGTAAATGCCTCCACTGGTTCGCTCCAAGGGTGGCCCGTGGGTTCCCCGGTGGGTAGGGGGGAAGGCCTCACCCGGTGGCTAAACCCGCCGGAGGAAAAAAGAAAAAGGAAGAGAAGGAAGGCCGAAAAGAGGGCGGGGCCAAACACTTCCACGAACCCCGGGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGCTGACGGTGAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838330
dbEST ID: 79656032
Trimmed Sequence: GTCCAGGAAGCCAAGGTCTGCGGCTTCTGAATACTGTGGGTGTAGAATCCGCGTTGCTAGCCGTTCTATATCATCCAGGCTGAGAAGGGATAAACTACGTTCATAGTCCTTCTGTACATATTCCAGCACTCTCTCTGCATCAGCTGGGCTGAAATGCTTCCTCAAGATTACACTCAGAGATTTCCATGCTGTATTATTCCCACTGTGGCCCTCTGGAGCCACTTGATCTTTCACCATGAGGTTTAGCCTTGATCCAGGACCGATAGAGTAATGGGAGAGGCAATGCTCATCTGCTAAGGATTTGCCTCTGAATAACAAACGTTGCTGTGACACCGGCACTTGCAGCTTTTCTTCCACTAGTCGTTTCACTGCTAGGACTGTGTCCCCTTCCGAGACCTGAATATGGGCCTCTTTTCCTTTCAATGCTTTCACCGTCAGCTGCATGG
Full Trace Sequence: GGGAATAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCCAGGAAGCCAAGGTCTGCGGCTTCTGAATACTGTGGGTGTAGAATCCGCGTTGCTAGCCGTTCTATATCATCCAGGCTGAGAAGGGATAAACTACGTTCATAGTCCTTCTGTACATATTCCAGCACTCTCTCTGCATCAGCTGGGCTGAAATGCTTCCTCAAGATTACACTCAGAGATTTCCATGCTGTATTATTCCCACTGTGGCCCTCTGGAGCCACTTGATCTTTCACCATGAGGTTTAGCCTTGATCCAGGACCGATAGAGTAATGGGAGAGGCAATGCTCATCTGCTAAGGATTTGCCTCTGAATAACAAACGTTGCTGTGACACCGGCACTTGCAGCTTTTCTTCCACTAGTCGTTTCACTGCTAGGACTGTGTCCCCTTCCGAGACCTGAATATGGGCCTCTTTTCCTTTCAATGCTTTCACCGTCAGCTGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGAATAAAATAAACAATGTACATCGTTTTACAAGTCAGAAAAATCGGGGAACAATTGGCTCAATTGCCTGCTACGCAAGGGGCCGTTGGCTTATCCTGTGTATGGCGGTGAGGCCCTACCAAAAAAAAAAAAACAAAATCGAATCTTTATCGATTTTTGAGATAACA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCAGGAAGCCAAGGT