ORFeome > march7 ORF1 – XORFeome v1.0

march7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: 39142
Gene ID: 962649
Gene Page ID: 962644
ORF Xenbase ID: 17283243

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124905
Original XGC clone length: 2199

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ837594
dbEST ID: 79655296
Trimmed Sequence: ATGGAACCAAAGCCATCAAGACTGCCTCGTAGGATAACTGTACAACCCTCCACCTTGTCCCCCATAACTTCACGGACCTCAAGGGTGGAACGATTAGGTGGAATCAGTGACACTTATAACAGAGACAGCTCAAGAAGACATGATCTTGACTATCAGGATTCTAGTACCTACCGTAATTCCAGTCGAGACTGGTCATTCAGGGAGAGGGACAGCTTTGAGCCTTCCTGGAAGACCACCACTTCATCTTACCAGCGCTGCTCAGGAACGTATGAGCAGCCCCTGTCTGGGGGCTTAGTATCAAGCAGGAGCCGTCTTTCAACATCATCTTCAACTCCTCAGTCAACGTACGAGCCATTGGAGAGGGCTCAGGGCACTTATACTGGATTGCACAGCCAGCAGCAGGATCGGGACTCAAAGAGACCAAAACTATCATATTCTGCTTATTCCTCTCTTTCTGGCATTAGAAGCACAAGTAGTGGTTTAAGTTCCACTTCAGATTCTACCAGCACGGTATGGAAGGTTTCCAAGGACTTCCCCTATGATGCTAGGTTCCAGTAGATCTGATTTTACTAGAGACCGAGAAAGGAGGACTGATTCAACCATCCACAGTCTTATGGATTATAGTCATAGAAACTCGGACACTACACAGTCATATCTTCAAGACAGAGTTTCTTCATATGCACAAGGAAGCAAGGGCCAAAGGATAAATTCCTTAAGCACATCTTCGACCCAACCACGTCTATCAGCCCACAGGCTTGCCTTTCTCAACACAACCTCCCCCCCTTCTAACGACAAAAAAACACCAA
Full Trace Sequence: GGCCCCAGATAATAGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAACCAAAGCCATCAAGACTGCCTCGTAGGATAACTGTACAACCCTCCACCTTGTCCCCCATAACTTCACGGACCTCAAGGGTGGAACGATTAGGTGGAATCAGTGACACTTATAACAGAGACAGCTCAAGAAGACATGATCTTGACTATCAGGATTCTAGTACCTACCGTAATTCCAGTCGAGACTGGTCATTCAGGGAGAGGGACAGCTTTGAGCCTTCCTGGAAGACCACCACTTCATCTTACCAGCGCTGCTCAGGAACGTATGAGCAGCCCCTGTCTGGGGGCTTAGTATCAAGCAGGAGCCGTCTTTCAACATCATCTTCAACTCCTCAGTCAACGTACGAGCCATTGGAGAGGGCTCAGGGCACTTATACTGGATTGCACAGCCAGCAGCAGGATCGGGACTCAAAGAGACCAAAACTATCATATTCTGCTTATTCCTCTCTTTCTGGCATTAGAAGCACAAGTAGTGGTTTAAGTTCCACTTCAGATTCTACCAGCACGGTATGGAAGGTTTCCAAGGACTTCCCCTATGATGCTAGGTTCCAGTAGATCTGATTTTACTAGAGACCGAGAAAGGAGGACTGATTCAACCATCCACAGTCTTATGGATTATAGTCATAGAAACTCGGACACTACACAGTCATATCTTCAAGACAGAGTTTCTTCATATGCACAAGGAAGCAAGGGCCAAAGGATAAATTCCTTAAGCACATCTTCGACCCAACCACGTCTATCAGCCCACAGGCTTGCCTTTCTCAACACAACCTCCCCCCCTTCTAACGACAAAAAAACACCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACCAAAGCCATCAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837593
dbEST ID: 79655295
Trimmed Sequence: TACCCTTTCATCTTCTGAATCTTCCTCTTCTGAAGTTTCAAGGTCATCCATGTGTGCTTGGAGAGTTCGGGCAAGATTTATAAATCTAACCCTAGTGCTTGCTTCATTAGCCGCTCCCAACATGTCAGAGAATCTCTGCTCACACAAGTGGAGCAAGACAACCAGGTACAGACCAGAGCTGATAAATTCATATTCGGCCCTCTCGCTGGCATGAGCACGATAAAGTTCCAGGATGTCAAAATCTTCCAAGTTCAGATCCAGTTTCTCTTTACACAATTCACATGTAGTTATGCTTTCTAGAGAAGTGCCAGAATTAATTTTTGCATTCAGCCATTTCTTCATACAGTCCTGATGAACATACTGAAGACTTCCAGAACATTTACATGGCTCTATGAAGGGATTCAATGGCGTCGTCATTCCTGTCTGGCATATTCTGCACAGATCTCCATCCTCTTCCTCAGAATCCTCTAGTAGAAGGCTTTCTTGAATTTGCTTTATTTTCTCTGGATCTCTGGAGGAAGTTTGAGACTTTTGACTATCTTGCACATCACTTGTCCTAACATCTACTGTTATCATGACATTGTCTGAGAGGGAGCTACTTAATGCACCGGGCACTGAAATTTGTAGAAATGAGCCCAGGAAGCATTCCCCGAAATGCCCGAAATTTCTCGCACCTAAATAAGGGAATCTGCCAAGGGAATGCTCCCACTTTAAAAAATCCCGTACTTAAAAATCTGGAAAAAGGAAAGCTTGGTGGCCTCCCATGAAAC
Full Trace Sequence: CGGAAACTGCTAATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACCCTTTCATCTTCTGAATCTTCCTCTTCTGAAGTTTCAAGGTCATCCATGTGTGCTTGGAGAGTTCGGGCAAGATTTATAAATCTAACCCTAGTGCTTGCTTCATTAGCCGCTCCCAACATGTCAGAGAATCTCTGCTCACACAAGTGGAGCAAGACAACCAGGTACAGACCAGAGCTGATAAATTCATATTCGGCCCTCTCGCTGGCATGAGCACGATAAAGTTCCAGGATGTCAAAATCTTCCAAGTTCAGATCCAGTTTCTCTTTACACAATTCACATGTAGTTATGCTTTCTAGAGAAGTGCCAGAATTAATTTTTGCATTCAGCCATTTCTTCATACAGTCCTGATGAACATACTGAAGACTTCCAGAACATTTACATGGCTCTATGAAGGGATTCAATGGCGTCGTCATTCCTGTCTGGCATATTCTGCACAGATCTCCATCCTCTTCCTCAGAATCCTCTAGTAGAAGGCTTTCTTGAATTTGCTTTATTTTCTCTGGATCTCTGGAGGAAGTTTGAGACTTTTGACTATCTTGCACATCACTTGTCCTAACATCTACTGTTATCATGACATTGTCTGAGAGGGAGCTACTTAATGCACCGGGCACTGAAATTTGTAGAAATGAGCCCAGGAAGCATTCCCCGAAATGCCCGAAATTTCTCGCACCTAAATAAGGGAATCTGCCAAGGGAATGCTCCCACTTTAAAAAATCCCGTACTTAAAAATCTGGAAAAAGGAAAGCTTGGTGGCCTCCCATGAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACCCTTTCATCTTCTGAATCTTC