ORFeome > marcks ORF1 – XORFeome v1.0

marcks ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: marcks
Gene ID: 6254948
Gene Page ID: 6258236
ORF Xenbase ID: 17283255

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041207
Original XGC clone length: 864

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11007
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ823570
dbEST ID: 79641272
Trimmed Sequence: ATGGGAGCCCAATTCTCCAAGACCGCAGCCAAAGGCGAAGCAGCTACCGCCGAGAAGCCCGGAGAAGCGGTGCCAGCGTCCCCATCCAAGGCAAACGGCCAGGAAAACGGTCATGTGAAGGTAAATGGAGATGCATCTCCTGCTGCAGCTGAGGCTGGAAAGGAAGAAGTTCAAGTCAATGGGAGTGCCCCTGCAGAGGAAACTGGCAAGGAGGAAGCTGCTTCAGCTGAAGCAGCTCCAGAGAAAGAGGCGGCTGCATCCCCTGCTGAAGGGGAGCCTGCAGAACCTGCTTCTCCAGCTGAAGGAGAACCAGCTGCTAAAACAGAGGAAGCAGGTTCAACCTCTACCCCTTCTACCAGCAATGAAACCCCCAAGAAGAAAAAGAAGCGTTTTTCATTCAAAAAATCCTTTAAGTTGAGTGGTTTCTCCTTTAAAAAGAACAAGAAGGAGAATAGTGAAGGAGCAGAGAATGAGGGTGCTGTTGCTTCCACTGAGGAGGCAAAAGAGGACACTGCTGCAGCTGCTCCAGAGGCTACAAATAGCGAAGAGGCCAAACCAGCCACAGAGGAGGCCCCTGCAGCCAGTTGCACAGAGGAGAAAAAGGAGGAGCCTGCAGCAGACGCATCTCCTGAAGTAGTGGAAACCAAAGCAGAAGAGGCTGCACCAGAAAAACCTTCAGTAGAAGAAGCTAAACCTGCTGAGGAGCAGAAGCCTGAGGAAAAGCCAGCAGAGGAGGCCCCAGCCCCAAGTGCTGCTCCTGAAGCCCCATCCACTGAACCAGAAGGCACCCAAAAGCGGAAAGAGCCAAGCAGTTCCCTAACCCGG
Full Trace Sequence: CAATATTGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAGCCCAATTCTCCAAGACCGCAGCCAAAGGCGAAGCAGCTACCGCCGAGAAGCCCGGAGAAGCGGTGCCAGCGTCCCCATCCAAGGCAAACGGCCAGGAAAACGGTCATGTGAAGGTAAATGGAGATGCATCTCCTGCTGCAGCTGAGGCTGGAAAGGAAGAAGTTCAAGTCAATGGGAGTGCCCCTGCAGAGGAAACTGGCAAGGAGGAAGCTGCTTCAGCTGAAGCAGCTCCAGAGAAAGAGGCGGCTGCATCCCCTGCTGAAGGGGAGCCTGCAGAACCTGCTTCTCCAGCTGAAGGAGAACCAGCTGCTAAAACAGAGGAAGCAGGTTCAACCTCTACCCCTTCTACCAGCAATGAAACCCCCAAGAAGAAAAAGAAGCGTTTTTCATTCAAAAAATCCTTTAAGTTGAGTGGTTTCTCCTTTAAAAAGAACAAGAAGGAGAATAGTGAAGGAGCAGAGAATGAGGGTGCTGTTGCTTCCACTGAGGAGGCAAAAGAGGACACTGCTGCAGCTGCTCCAGAGGCTACAAATAGCGAAGAGGCCAAACCAGCCACAGAGGAGGCCCCTGCAGCCAGTTGCACAGAGGAGAAAAAGGAGGAGCCTGCAGCAGACGCATCTCCTGAAGTAGTGGAAACCAAAGCAGAAGAGGCTGCACCAGAAAAACCTTCAGTAGAAGAAGCTAAACCTGCTGAGGAGCAGAAGCCTGAGGAAAAGCCAGCAGAGGAGGCCCCAGCCCCAAGTGCTGCTCCTGAAGCCCCATCCACTGAACCAGAAGGCACCCAAAAGCGGAAAGAGCCAAGCAGTTCCCTAACCCGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGCCCAATTCTCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ828868
dbEST ID: 79646570
Trimmed Sequence: CTCTGCTGAATCTGCTGCTGGACTAGATTCAGATGTAGCTTCCTGTGTAGGAACTGCTGGCTCTTCGGCTTTGGGTGCCTCTGGTTCAGTGGATGGGGCTTCAGGAGCAGCACTTGGGGCTGGGGCCTCCTCTGCTGGCTTTTCCTCAGGCTTCTGCTCCTCAGCAGGTTTAGCTTCTTCTACTGAAGGTTTTTCTGGTGCAGCCTCTTCTGCTTTGGTTTCCACTACTTCAGGAGATGCGTCTGCTGCAGGCTCCTCCTTTTTCTCCTCTGTGCAACTGGCTGCAGGGGCCTCCTCTGTGGCTGGTTTGGCCTCTTCGCTATTTGTAGCCTCTGGAGCAGCTGCAGCAGTGTCCTCTTTTGCCTCCTCAGTGGAAGCAACAGCACCCTCATTCTCTGCTCCTTCACTATTCTCCTTCTTGTTCTTTTTAAAGGAGAAACCACTCAACTTAAAGGATTTTTTGAATGAAAAACGCTTCTTTTTCTTCTTGGGGGTTTCATTGCTGGTAGAAGGGGTAGAGGTTGAACCTGCTTCCTCTGTTTTAACAGCTGGTTCTCCTTCAGCTGGAGAAGCAGGTTCTGCAGGCTCCCCTTCAGCAGGGGATGCAGCCCCCTCTTTCTCTGGAGCTGCTTCAGCTAAAGCAGCTTTCCTCCTTGCCCAGTTTCCTCGGCAGGGGGCACTCCCTTTGAACTTGAACTTCCTTCCT
Full Trace Sequence: TGCCGCGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTGCTGAATCTGCTGCTGGACTAGATTCAGATGTAGCTTCCTGTGTAGGAACTGCTGGCTCTTCGGCTTTGGGTGCCTCTGGTTCAGTGGATGGGGCTTCAGGAGCAGCACTTGGGGCTGGGGCCTCCTCTGCTGGCTTTTCCTCAGGCTTCTGCTCCTCAGCAGGTTTAGCTTCTTCTACTGAAGGTTTTTCTGGTGCAGCCTCTTCTGCTTTGGTTTCCACTACTTCAGGAGATGCGTCTGCTGCAGGCTCCTCCTTTTTCTCCTCTGTGCAACTGGCTGCAGGGGCCTCCTCTGTGGCTGGTTTGGCCTCTTCGCTATTTGTAGCCTCTGGAGCAGCTGCAGCAGTGTCCTCTTTTGCCTCCTCAGTGGAAGCAACAGCACCCTCATTCTCTGCTCCTTCACTATTCTCCTTCTTGTTCTTTTTAAAGGAGAAACCACTCAACTTAAAGGATTTTTTGAATGAAAAACGCTTCTTTTTCTTCTTGGGGGTTTCATTGCTGGTAGAAGGGGTAGAGGTTGAACCTGCTTCCTCTGTTTTAACAGCTGGTTCTCCTTCAGCTGGAGAAGCAGGTTCTGCAGGCTCCCCTTCAGCAGGGGATGCAGCCCCCTCTTTCTCTGGAGCTGCTTCAGCTAAAGCAGCTTTCCTCCTTGCCCAGTTTCCTCGGCAGGGGGCACTCCCTTTGAACTTGAACTTCCTTCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTGCTGAATCTGCTGCT