ORFeome > mat2b ORF1 – XORFeome v1.0

mat2b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mat2b
Gene ID: 972027
Gene Page ID: 972022
ORF Xenbase ID: 17283303

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097788
Original XGC clone length: 1005

Human orthology & disease relationships

NCBI Entrez ID: 27430
Ensembl gene IDs: ENSG00000038274
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 194050,229100,242860,250940,605850,605899

Library Location

Plate ID: GDExl11089
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ838445
dbEST ID: 79656147
Trimmed Sequence: ATGGAAGGGAGATACAAGGACTACAGGATCCGCTTCTCACCCGGCTGGGTCGAGGTTGTGCAGGATGATGTTACTGTTCCTAGTAGAAGGGCTCTGATAACGGGGGCAACCGGACTTCTTGGTCGAGCTGTATACAAAGAGTTTAAGGAGAACAGCTGGCATGTGCTGGGCTGCGGGTACAGTCGTGCTCGACCCAGATTCGAATGCCTCAACCTATTGGATGAAGCAGCGGTGAAAGCATTGATCCAAGACTTCAAGCCTCACGTGATCATTCATTGTGCTGCAGAGAGGAGACCAGATATTGTCGAAAGTCAACCAGAGTTAGCTTCATTACTAAATGTGGTGGCATCTGAGAATTTAGCAAAAGTAGCCGCTGGAGTTGGAGCGTTTCTAATTTATGTTAGCTCAGATTATGTCTTTGATGGAACAAGCCCGCCTTACAGGGAAGATTCCATACCACATCCCTTGAACCTTTATGGCAAGACAAAACTGGATGGAGAGAGAGCAGTGTTGCAGAATAATGAAGGTGCTGCAGTTCTTCGAGTGCCAGTTATGTATGGAGACGTGGAGGAGCTTAGTGAAAGTGCTGTCGCGGGTCTTTTTTGATATGTGCAGTGTAGCGACAAGTCCGCAAATCTGGACCATTGTCCGCGGAG
Full Trace Sequence: GGGGGGCCCATATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGGGAGATACAAGGACTACAGGATCCGCTTCTCACCCGGCTGGGTCGAGGTTGTGCAGGATGATGTTACTGTTCCTAGTAGAAGGGCTCTGATAACGGGGGCAACCGGACTTCTTGGTCGAGCTGTATACAAAGAGTTTAAGGAGAACAGCTGGCATGTGCTGGGCTGCGGGTACAGTCGTGCTCGACCCAGATTCGAATGCCTCAACCTATTGGATGAAGCAGCGGTGAAAGCATTGATCCAAGACTTCAAGCCTCACGTGATCATTCATTGTGCTGCAGAGAGGAGACCAGATATTGTCGAAAGTCAACCAGAGTTAGCTTCATTACTAAATGTGGTGGCATCTGAGAATTTAGCAAAAGTAGCCGCTGGAGTTGGAGCGTTTCTAATTTATGTTAGCTCAGATTATGTCTTTGATGGAACAAGCCCGCCTTACAGGGAAGATTCCATACCACATCCCTTGAACCTTTATGGCAAGACAAAACTGGATGGAGAGAGAGCAGTGTTGCAGAATAATGAAGGTGCTGCAGTTCTTCGAGTGCCAGTTATGTATGGAGACGTGGAGGAGCTTAGTGAAAGTGCTGTCGCGGGTCTTTTTTGATATGTGCAGTGTAGCGACAAGTCCGCAAATCTGGACCATTGTCCGCGGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGGGAGATACAAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838444
dbEST ID: 79656146
Trimmed Sequence: GTGGAAGACTGTCTGTCTCCATCTCTTGTCCACTAAGAACGGCCAGAGGGTTTCCCTAATTCCCACTCTAAACGGTGTTCTCTGGCCAATGCCCATCTTCTCCAGTTTCGAACAGTCCAGTTGTGGATTCCATGGCCGAGGAGTCGCTCCTACGGGCTCATCTGTGATTGGACGCAGATGGCTGCTGGGAAGGTTGAAGGCATCTGCCATGGCACAAGCTATTTCGTATTTGGTCATCTGCTCATTTCCAGACCAATGGTATATTCCCTTAATAGAGGGATCCTGTATTTTTCGCTCTGTTAATTGAAGACAAACTGTAGCAACATCTTTGACATGAGTAGGAAACCTTTGCTGACAATGGTCCAGATTTGCCGACTTGTTGCTAAACTGCACCTTATCAAGAAGAATTGTGACGGCACTTTCACTACATTTTTCCGCGTCACCATACATAACTGGCACTGGAAGAACTGCAGCACCTTCCTTATTCTGCAACACTGCTCTCGGCTCCTCCAGTTTTTGTCTTGGCGTAGGAGATTCAAAGGGAGGTGGGAGGGAGGCTTCCCTCTAAGGGGGGGGGTGGTGGTTCGGGAAACAATAAACGTAGCTAGGGGGAATTAAAAAGGCTGCCACCCCCACCCGCGTACTTTGTTCAAAGTTCTGG
Full Trace Sequence: GGCACTCGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGGAAGACTGTCTGTCTCCATCTCTTGTCCACTAAGAACGGCCAGAGGGTTTCCCTAATTCCCACTCTAAACGGTGTTCTCTGGCCAATGCCCATCTTCTCCAGTTTCGAACAGTCCAGTTGTGGATTCCATGGCCGAGGAGTCGCTCCTACGGGCTCATCTGTGATTGGACGCAGATGGCTGCTGGGAAGGTTGAAGGCATCTGCCATGGCACAAGCTATTTCGTATTTGGTCATCTGCTCATTTCCAGACCAATGGTATATTCCCTTAATAGAGGGATCCTGTATTTTTCGCTCTGTTAATTGAAGACAAACTGTAGCAACATCTTTGACATGAGTAGGAAACCTTTGCTGACAATGGTCCAGATTTGCCGACTTGTTGCTAAACTGCACCTTATCAAGAAGAATTGTGACGGCACTTTCACTACATTTTTCCGCGTCACCATACATAACTGGCACTGGAAGAACTGCAGCACCTTCCTTATTCTGCAACACTGCTCTCGGCTCCTCCAGTTTTTGTCTTGGCGTAGGAGATTCAAAGGGAGGTGGGAGGGAGGCTTCCCTCTAAGGGGGGGGGTGGTGGTTCGGGAAACAATAAACGTAGCTAGGGGGAATTAAAAAGGCTGCCACCCCCACCCGCGTACTTTGTTCAAAGTTCTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGAAGACTGTCTGTCTCCAT