ORFeome > matn1 ORF1 – XORFeome v1.0

matn1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: matn1
Gene ID: 957564
Gene Page ID: 957558
ORF Xenbase ID: 17283309

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054272
Original XGC clone length: 1473

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: F01

Sequences - 5ʹ (forward) EST

Accession: JZ839176
dbEST ID: 79656878
Trimmed Sequence: ATGAGGACTTCTCTGTGTCTCCTGACCACTCTTCTCCTCTGCTATCACCATGCCACTCATGGAGCTTCTCTTCAAGCACAGAAGGGACCCAATTGTAGAACCCGACCCACCGACATACTGTTCATCATAGACAGCTCACGTAGCGTTCGCCCTTCTGAATTCGAGCAAGCCAAGGTCTTCCTGTCCCAGGTCATCGAGTCGCTGGATGTTGGAGCCAATGCGACCAGAGTGGGGTTGGTAAACTATGCCAGCACAGTGAAAAATGAATTTTCTCTCAAAACACACAAAGCAAAGCCAGCACTTCTTCAAGCTGTGAAAAAAGTCCAGCCACTCTCAACTGGCACAATGACAGGCCTTGCTATTCAATATGCTATGAACAATGCCTTCACAGAGTCTGAGGGGGCCCGAATAAAGTCTCCTGGCATCAATAAGGTTGCAATCGTTGTTACTGATGGCCGACCCCAGGACACTGTGAAAGATATCTCTGCACGGGCAAGGGAAAGCGGATTAGAAATATATGCTATTGGAGTAGGACGTGTGGATAAGAACACCTTGCGTCAGATTGCCAGCGAACCACTAGATGAACATGTTGACTATGTGGAAAGTTACAGTTTGATTGAGAAACTTAACAAGAAATTTCAGGAAGCATTCTGTGTAACGGCTGACCTATGTTCTACTGGAAATCATGACTGCAAACAAATTTGTGTCAACACCCCAGGGTTCCTACCCCTTGTGCCTG
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGACTTCTCTGTGTCTCCTGACCACTCTTCTCCTCTGCTATCACCATGCCACTCATGGAGCTTCTCTTCAAGCACAGAAGGGACCCAATTGTAGAACCCGACCCACCGACATACTGTTCATCATAGACAGCTCACGTAGCGTTCGCCCTTCTGAATTCGAGCAAGCCAAGGTCTTCCTGTCCCAGGTCATCGAGTCGCTGGATGTTGGAGCCAATGCGACCAGAGTGGGGTTGGTAAACTATGCCAGCACAGTGAAAAATGAATTTTCTCTCAAAACACACAAAGCAAAGCCAGCACTTCTTCAAGCTGTGAAAAAAGTCCAGCCACTCTCAACTGGCACAATGACAGGCCTTGCTATTCAATATGCTATGAACAATGCCTTCACAGAGTCTGAGGGGGCCCGAATAAAGTCTCCTGGCATCAATAAGGTTGCAATCGTTGTTACTGATGGCCGACCCCAGGACACTGTGAAAGATATCTCTGCACGGGCAAGGGAAAGCGGATTAGAAATATATGCTATTGGAGTAGGACGTGTGGATAAGAACACCTTGCGTCAGATTGCCAGCGAACCACTAGATGAACATGTTGACTATGTGGAAAGTTACAGTTTGATTGAGAAACTTAACAAGAAATTTCAGGAAGCATTCTGTGTAACGGCTGACCTATGTTCTACTGGAAATCATGACTGCAAACAAATTTGTGTCAACACCCCAGGGTTCCTACCCCTTGTGCCTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGACTTCTCTGTGTCTCCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839175
dbEST ID: 79656877
Trimmed Sequence: CACTGTGATTTTGTTCTCTAAAGCAGCAAGTTTCTTAGATACTGCTTCAATCTTTTTTGTAAGCTGCTGGATGAGATCTTCAACCTTAGTCTGGAATTTGACTATAGACTCGCACTCACATGGGTTTTCTTCCACACATATCTTCATCTGAAGCTTCTTGCCAATCTCCTTCATTGCCTTGAAATCCGCTGTGTAGAAGGAATGCTCTGCCTGAGGTTCAGAAGCAATCATTCTGAGCTCTTCTTCCACAGCATTTCCGACGCCAACAGCGAACATCTTGTAACCCAGCTCCTTAGCTCTGGCAGCAGCATCATTGATGTAATCCTGAGATCGCCCATCAGTAAAGACAATGCCAACTTTGGGTACAGCTGGTCTACCTCCACTGGAGATGGCAAAGCTGTTGTCGACAAGATACTGCAGGGCCTGACCTGTCATGGTGCCCTTTTCCATGTAGGACATTTTCTTTACTGCAGATTTAATGTCTTTTTTAGAACTATACCTGCCCAGGGGGAACTCTTGTCTAACTGAGCTGGAATATTGCACTAAGCCCACATGAGCCCTCCTTTCGCCTACATCCATAGAATCCACAATCTGGTTGATGAACTGCTTGACGAGTTCAAAGTTCTCAAGCCGTACACTCTTAAAGCCCTCCATAAGGAAAAACCAAGTCAACAGCAAAAGGCTTCCCCAAGGCATTTGCAAGTTCTTTGCCATCTTTCATTTTAA
Full Trace Sequence: GCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACTGTGATTTTGTTCTCTAAAGCAGCAAGTTTCTTAGATACTGCTTCAATCTTTTTTGTAAGCTGCTGGATGAGATCTTCAACCTTAGTCTGGAATTTGACTATAGACTCGCACTCACATGGGTTTTCTTCCACACATATCTTCATCTGAAGCTTCTTGCCAATCTCCTTCATTGCCTTGAAATCCGCTGTGTAGAAGGAATGCTCTGCCTGAGGTTCAGAAGCAATCATTCTGAGCTCTTCTTCCACAGCATTTCCGACGCCAACAGCGAACATCTTGTAACCCAGCTCCTTAGCTCTGGCAGCAGCATCATTGATGTAATCCTGAGATCGCCCATCAGTAAAGACAATGCCAACTTTGGGTACAGCTGGTCTACCTCCACTGGAGATGGCAAAGCTGTTGTCGACAAGATACTGCAGGGCCTGACCTGTCATGGTGCCCTTTTCCATGTAGGACATTTTCTTTACTGCAGATTTAATGTCTTTTTTAGAACTATACCTGCCCAGGGGGAACTCTTGTCTAACTGAGCTGGAATATTGCACTAAGCCCACATGAGCCCTCCTTTCGCCTACATCCATAGAATCCACAATCTGGTTGATGAACTGCTTGACGAGTTCAAAGTTCTCAAGCCGTACACTCTTAAAGCCCTCCATAAGGAAAAACCAAGTCAACAGCAAAAGGCTTCCCCAAGGCATTTGCAAGTTCTTTGCCATCTTTCATTTTAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTGTGATTTTGTTCTCTAAAGC