ORFeome > matn2 ORF1 – XORFeome v1.0

matn2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: matn2
Gene ID: 6254063
Gene Page ID: 6458238
ORF Xenbase ID: 17283315

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045220
Original XGC clone length: 1770

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ823938
dbEST ID: 79641640
Trimmed Sequence: ATGAGCCTCATTCATTCCTGCTTCCTTGCCCTCTTGTTGTTCCTGGGTGTGGATGGCAGAGAGAAGCGACAGTCAGCAGCTGTCACAGCCCGAAGAAATGAAATTGATAGTCAAGCAGCCTTCCTCAGGAGCGCGTGCCATAACAAGCCGCTGGATCTGGTGTTTATCATCGATAGCTCTCGCAGTGTACGTCCTGCTGACTTTGAGAAAGTGAAGGAATTTCTTATCACCATGTTGAAATTCCTAGACATCGGCCCGGACACCACAAGGGTTGGACTCCTACAGTATGGCAGCACCGTAAAAAATGAGTTTTCTTTAAAGATGTACAAGAGGAAATCTGACATTGAGAGAGCCGTGAAAAGAATGATGCATTTGGCCACTGGCACCATGACCGGACTGGCTATCCAGTATGCCATGAACATTGCCTTCTCTGAAGCTGAAGGGGCACGGCCCTTAAACCAATATGTGCCTAGAATTGCCATGATTGTGACAGACGGGAGGCCACAGGATCCAGTAGAGGAAATTTCAGCCAAGGCAAGGATGTCTGGGATTCTCATCTTTGCCATTGGGGTCGGGCGAGTTGATATGAGCACTTTAAAAACCATTGGAAGTGACCNCACAGCGAGCATGTGTTTTTGGTGGCAAATTTTAGCCAATTTGAACACTGACGTCTGTCTTCAGAANCAACTATGTGCCCCACATCTCTGTACACAGCCCTAAATGGGTGGTGATCCTTTTGGATCATACCCAGGGTCCCAAATTTTTTCATGAAACCAAGGAAACTTCTTGAACCCTTGAGAAAAAAATGAGCACCTCAGAACCATGGTCCCCCAAAAAAA
Full Trace Sequence: AATGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCCTCATTCATTCCTGCTTCCTTGCCCTCTTGTTGTTCCTGGGTGTGGATGGCAGAGAGAAGCGACAGTCAGCAGCTGTCACAGCCCGAAGAAATGAAATTGATAGTCAAGCAGCCTTCCTCAGGAGCGCGTGCCATAACAAGCCGCTGGATCTGGTGTTTATCATCGATAGCTCTCGCAGTGTACGTCCTGCTGACTTTGAGAAAGTGAAGGAATTTCTTATCACCATGTTGAAATTCCTAGACATCGGCCCGGACACCACAAGGGTTGGACTCCTACAGTATGGCAGCACCGTAAAAAATGAGTTTTCTTTAAAGATGTACAAGAGGAAATCTGACATTGAGAGAGCCGTGAAAAGAATGATGCATTTGGCCACTGGCACCATGACCGGACTGGCTATCCAGTATGCCATGAACATTGCCTTCTCTGAAGCTGAAGGGGCACGGCCCTTAAACCAATATGTGCCTAGAATTGCCATGATTGTGACAGACGGGAGGCCACAGGATCCAGTAGAGGAAATTTCAGCCAAGGCAAGGATGTCTGGGATTCTCATCTTTGCCATTGGGGTCGGGCGAGTTGATATGAGCACTTTAAAAACCATTGGAAGTGACCNCACAGCGAGCATGTGTTTTTGGTGGCAAATTTTAGCCAATTTGAACACTGACGTCTGTCTTCAGAANCAACTATGTGCCCCACATCTCTGTACACAGCCCTAAATGGGTGGTGATCCTTTTGGATCATACCCAGGGTCCCAAATTTTTTCATGAAACCAAGGAAACTTCTTGAACCCTTGAGAAAAAAATGAGCACCTCAGAACCATGGTCCCCCAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCCTCATTCATTCCTGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829247
dbEST ID: 79646949
Trimmed Sequence: CAATCTCAAAGTTGTCTTCTCCAAGGCTTTTGGACCCATCAATAACAAATACCAAATCGACTGGCCCTTCCCCACATTTTTTCCACTTTTGCAGCTTTTTCCATCTTCTCCTAAGCTGTATTCTTCAAAACATTTGCAGAGGTAGGAATTATCGCTGTTGACGCAGATATGCTCACAGCCGTGGTCAAGTGACTTGCAAAGATCTCGACTTTTACATGTCTTTTTATCATCTCGGAGGTCATAGCCTTCAAAGCAATGGCAAGTGTAGGAGCCTTCAGTATTGACACACAAGTGCTCACAGTCGTGGTTGTTCGAGGCACAGTGGTCCACCGCCCTGCAGGTTTTTAGGTCTTCATTTAGGAGAAACCCTTCATAGCACTGACAAATAAAGGAATCATCGGTATTCATGCAGATATGCTGGCATCCATGGCTGGTCTCAGCACAGCGGTCCACTTTTCTGCAGGTTCTCCCGTCCTGGTTCAAAGTGTAACCTTTGTGGCATCGGCATATGAATGAGTTGTCGGTGTTGACACATTCGTGTTGGCATCCGTTCCTGCCCAGAGCACAGTGGTTTGATTTTCTGGCAGTTTTTCTTGTCTGGGTTAAGAGAAAATCCACTGGCGGATTTTCAGACAAAGGGATTCCTCATTATTTCACGCCACTCATGCTTAACCGCCATGGGTTGGGAAATGGGCACAAAAAATTCTTGG
Full Trace Sequence: CTGGCAGGAAGCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAATCTCAAAGTTGTCTTCTCCAAGGCTTTTGGACCCATCAATAACAAATACCAAATCGACTGGCCCTTCCCCACATTTTTTCCACTTTTGCAGCTTTTTCCATCTTCTCCTAAGCTGTATTCTTCAAAACATTTGCAGAGGTAGGAATTATCGCTGTTGACGCAGATATGCTCACAGCCGTGGTCAAGTGACTTGCAAAGATCTCGACTTTTACATGTCTTTTTATCATCTCGGAGGTCATAGCCTTCAAAGCAATGGCAAGTGTAGGAGCCTTCAGTATTGACACACAAGTGCTCACAGTCGTGGTTGTTCGAGGCACAGTGGTCCACCGCCCTGCAGGTTTTTAGGTCTTCATTTAGGAGAAACCCTTCATAGCACTGACAAATAAAGGAATCATCGGTATTCATGCAGATATGCTGGCATCCATGGCTGGTCTCAGCACAGCGGTCCACTTTTCTGCAGGTTCTCCCGTCCTGGTTCAAAGTGTAACCTTTGTGGCATCGGCATATGAATGAGTTGTCGGTGTTGACACATTCGTGTTGGCATCCGTTCCTGCCCAGAGCACAGTGGTTTGATTTTCTGGCAGTTTTTCTTGTCTGGGTTAAGAGAAAATCCACTGGCGGATTTTCAGACAAAGGGATTCCTCATTATTTCACGCCACTCATGCTTAACCGCCATGGGTTGGGAAATGGGCACAAAAAATTCTTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAATCTCAAAGTTGTCTTCTCC