ORFeome > Mbp ORF1 – XORFeome v1.0

Mbp ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6254424
Gene Page ID:
ORF Xenbase ID: 17262435

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129777
Original XGC clone length: 531

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ840251
dbEST ID: 79657953
Trimmed Sequence: ATGGCATCACAGAAACATTCTCTGTGGGCACGGATCAAAGCAAATGGCAACAGCAAGCACCTACTATCACTCTAGGCATGGGTATGGAGCCCATGGAAAGCACAGGGACTCGAGTCTTCTTGACTCACTGGGCAGGTTCTTTGGAGGGGAGAGATCTGTTCCTAGGAAGGGATCAGGAAAGGAGGTACATATGTCAAGATCAGGCTACCTAAGTTCTTCTCCCCATATATCTCCTTACCATGCTCATGGTAGGCACGTTGATGACAACCCTGTTGTTCACTTCTTCAGGAACATAATGTCACCCATGACACCACCTCCTTCTCAACCAAAGAGAGGATTCTCCACATTTATCTGGGGAGCCGAGAACCACAGCCCATACAATGGAGGATATGGTTCCCGGTCCTTGCATCACCACAAATCATCCTACAAGGGATATAACGATCCACACACAGAAGGCCATGGATCTCTGTCGAGGATCTTCAAACTGGAGAAGACAGCACAAACCGATCTTCTTCTCCAATCGCGAAGACTTTGTCCACTTTCTTGTACAAGGAAGGAATAATAAGAAGGCATTGCTTATCAATTTTGAGGCAACCAACAAGGTACCATCCAAGCAAAATAAAATCAATATTTTCCAACCAAGTTGATATCCCCAAACAAGGAGTCATACTACAAAGGACACAACTGGTTTACAGGTCAACTCTAGGCACCTTATCTCAAAAATTCTTTGTAAATATTAAAAAATAA
Full Trace Sequence: GGGGGGGGGTTGGGGGCGGAAATTAGTGGGACCAAAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCATCACAGAAACATTCTCTGTGGGCACGGATCAAAGCAAATGGCAACAGCAAGCACCTACTATCACTCTAGGCATGGGTATGGAGCCCATGGAAAGCACAGGGACTCGAGTCTTCTTGACTCACTGGGCAGGTTCTTTGGAGGGGAGAGATCTGTTCCTAGGAAGGGATCAGGAAAGGAGGTACATATGTCAAGATCAGGCTACCTAAGTTCTTCTCCCCATATATCTCCTTACCATGCTCATGGTAGGCACGTTGATGACAACCCTGTTGTTCACTTCTTCAGGAACATAATGTCACCCATGACACCACCTCCTTCTCAACCAAAGAGAGGATTCTCCACATTTATCTGGGGAGCCGAGAACCACAGCCCATACAATGGAGGATATGGTTCCCGGTCCTTGCATCACCACAAATCATCCTACAAGGGATATAACGATCCACACACAGAAGGCCATGGATCTCTGTCGAGGATCTTCAAACTGGAGAAGACAGCACAAACCGATCTTCTTCTCCAATCGCGAAGACTTTGTCCACTTTCTTGTACAAGGAAGGAATAATAAGAAGGCATTGCTTATCAATTTTGAGGCAACCAACAAGGTACCATCCAAGCAAAATAAAATCAATATTTTCCAACCAAGTTGATATCCCCAAACAAGGAGTCATACTACAAAGGACACAACTGGTTTACAGGTCAACTCTAGGCACCTTATCTCAAAAATTCTTTGTAAATATTAAAAAATAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCATCACAGAAACATTCTC

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGAAGCGGACTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCNNCNATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAACAAAGTTGGCAAACGCCTGGCCAAAGGAGAAAATAACCTTACTTCACTGTCCACCCAGTTTGAACATCCTACACCGAAATACATGGCCTTCTCACTGAGCAACCCTATATCACTCGCCCAATGATATGGGATGATCCACCGACATGCAACCAAATCCTCCGCATCATGCCCATGCACTTCTCGGCTACCCAATACAAGCTAGAGAATCCTCACTTCCGTACACATTAAATCCGGGTGCTCCTGGACACACCGAATACTCACTAGCTGAACTTTTGGCTAATCATAAACGTTCCTCCGCCCATCATAGTTACCAAACTTCTCCGGCAGAAAAATAAATCAAGCCCGATCTGTCCTTATTGTCTCTCCTAAACTTATCCCATCAAACTATTCAATCTCGCACCTCCATACACACCGACACACCACCTAAGAATAACTCCCATGACGTCCCCTCTAAGATTTTCATACTCTTCCTTACGTGCTCCTCGGGTGCATCATCAAGACGTTGCACTCGTACCTACGCCCTCTGTTGTAACCCGCAATACCAGGAAGCCCATTTCTTAGCCCGCCTTTTTATTATCCCTCCCCCCCGTTCCGCCGTTGGTCCCCAACTACCCCTTGGCTATCACGTAACAGCATCCCCTGATTTTTGGCACTGGTTCTTCCTTGTTTCCCCTATTTACACTATTCACCGCAGGGCTAATTACCAGATCCCTTAGGAATATAAACTCACCCCAATATCCGGGACGCGCTCCCCCCACTTATTTTTATCTCCCAAGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGCCTGGCCATAGGAGA