ORFeome > mcee ORF1 – XORFeome v1.0

mcee ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mcee
Gene ID: 6255570
Gene Page ID: 5803455
ORF Xenbase ID: 17283387

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099288
Original XGC clone length: 525

Human orthology & disease relationships

NCBI Entrez ID: 84693
Ensembl gene IDs: ENSG00000124370
Directly associated (OMIM) disease MIM numbers: 251120
Indirectly associated (Lage, et al.) disease MIM numbers: 242100,251000,252011,605373,606054,609015

Library Location

Plate ID: GDExl11006
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ840132
dbEST ID: 79657834
Trimmed Sequence: ATGGCGGCGCACAGAGTTAGGACTGCTGCAGGCCTATTAAGCAGAGTCTGTGGACTTGCCCAAGCCCGGAGAAACTTTGCAATTTCGCAATCTGTAGGTCAGAAAGTCCCCGACCCCGTATGGAATCTGGGACGTCTCAATCATGTTGCCATTGCTGTGCCTGATTTAGAGAAAGCCCGCTCTTTATATGAGAAGGTTTTAGGGGCTCATGTGAGTGAGACTGTTCCTCTACCTGAGCATGGTGTATACACTGTTTTTGTGGAGCTTGGGAACACAAAACTGGAACTTCTACACCCCTTGGGACAGAACAGTCCAATTTCTGGGTTTTTACAGAAAAACAAGGCAGGTGGATTGCATCATATATGCATTGAGGTTGATGACATTAAAGCAGCAATGACCAGTTTAAAAGAGAAAAAAATCAAAATCCTAAGCGAAGAACCAAGAATAGGCGCACACGGAAAGCCAGTTGTCTTCTTGCATCCAAAAGATTGCGATGGAGTTCTCGTAGAGCTTGAAGAAGCCTT
Full Trace Sequence: CGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCGGCAATTGAGGAGCAATGCTTTTTTATGATGCCGACTTTGTACACAAAGTTGGCACCATGGCGGCGCACAGAGTTAGGACTGCTGCAGGCCTATTAAGCAGAGTCTGTGGACTTGCCCAAGCCCGGAGAAACTTTGCAATTTCGCAATCTGTAGGTCAGAAAGTCCCCGACCCCGTATGGAATCTGGGACGTCTCAATCATGTTGCCATTGCTGTGCCTGATTTAGAGAAAGCCCGCTCTTTATATGAGAAGGTTTTAGGGGCTCATGTGAGTGAGACTGTTCCTCTACCTGAGCATGGTGTATACACTGTTTTTGTGGAGCTTGGGAACACAAAACTGGAACTTCTACACCCCTTGGGACAGAACAGTCCAATTTCTGGGTTTTTACAGAAAAACAAGGCAGGTGGATTGCATCATATATGCATTGAGGTTGATGACATTAAAGCAGCAATGACCAGTTTAAAAGAGAAAAAAATCAAAATCCTAAGCGAAGAACCAAGAATAGGCGCACACGGAAAGCCAGTTGTCTTCTTGCATCCAAAAGATTGCGATGGAGTTCTCGTAGAGCTTGAAGAAGCCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCCTCCCGCTGATATCCCCTATAGTGAGTCGTATACATGGTCATAACTGGTTCCTGGAAACTACTAGAACGTGTCTCAAAACCCCTTAAGTGTACAAANGAANANNAANNANGGNNGNNAANNNNNNNNNNNCNNNNNNCNNCATCCGGNTNNNNNGTGTTGTTTTTTTGTTTTTGTTGGNTGTGANTAAGTN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGCACAGAGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ840131
dbEST ID: 79657833
Trimmed Sequence: GGCTTCTTCAAGCTCTACGAGAACTCCATCGCAATCTTTTGGATGCAAGAAGACAACTGGCTTTCCGTGTGCGCCTATTCTTGGTTCTTCGCTTAGGATTTTGATTTTTTTCTCTTTTAAACTGGTCATTGCTGCTTTAATGTCATCAACCTCAATGCATATATGATGCAATCCACCTGCCTTGTTTTTCTGTAAAAACCCAGAAATTGGACTGTTCTGTCCCAAGGGGTGTAGAAGTTCCAGTTTTGTGTTCCCAAGCTCCACAAAAACAGTGTATACACCATGCTCAGGTAGAGGAACAGTCTCACTCACATGAGCCCCTAAAACCTTCTCATATAAAGAGCGGGCTTTCTCTAAATCAGGCACAGCAATGGCAACATGATTGAGACGTCCCAGATTCCATACGGGGTCGGGGACTTTCTGACCTACAGATTGCGAAATTGCAAAGTTTCTCCGGGCTTGGGCAAGTCCACAGACTCTGCTTAATAGGCCTGCACCAGTCCTAACTCTGTGCGCCGCCATGGGTGCA
Full Trace Sequence: GGCGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAGTTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCTTCTTCAAGCTCTACGAGAACTCCATCGCAATCTTTTGGATGCAAGAAGACAACTGGCTTTCCGTGTGCGCCTATTCTTGGTTCTTCGCTTAGGATTTTGATTTTTTTCTCTTTTAAACTGGTCATTGCTGCTTTAATGTCATCAACCTCAATGCATATATGATGCAATCCACCTGCCTTGTTTTTCTGTAAAAACCCAGAAATTGGACTGTTCTGTCCCAAGGGGTGTAGAAGTTCCAGTTTTGTGTTCCCAAGCTCCACAAAAACAGTGTATACACCATGCTCAGGTAGAGGAACAGTCTCACTCACATGAGCCCCTAAAACCTTCTCATATAAAGAGCGGGCTTTCTCTAAATCAGGCACAGCAATGGCAACATGATTGAGACGTCCCAGATTCCATACGGGGTCGGGGACTTTCTGACCTACAGATTGCGAAATTGCAAAGTTTCTCCGGGCTTGGGCAAGTCCACAGACTCTGCTTAATAGGCCTGCACCAGTCCTAACTCTGTGCGCCGCCATGGGTGCAAATTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACAAAAAGGTCACCATCCATCAAAAATAGATCATTATTTGGAAAAAAAAAAAAAAACTGGACAATCATTTTACAAGACTCGGGACTTGGGGGGTGCCAAAGAACCCCGGGCCCCGTGCAGACAGAAGGGTTGTGGGGGTGTATAGTTTGGTGGGGAGGGGAGAACCCCCAAGCCGGAGAGAAAAAAAACAGGCCGAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCTTCTTCAAGCTCTAC