ORFeome > mcm3 ORF1 – XORFeome v1.0

mcm3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mcm3
Gene ID: 5857895
Gene Page ID: 5857844
ORF Xenbase ID: 17283411

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110950
Original XGC clone length: 2424

Human orthology & disease relationships

NCBI Entrez ID: 4172
Ensembl gene IDs: ENSG00000112118
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 194050,216400,223100,259500,277700

Library Location

Plate ID: GDExl11085
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CTCGAGGGCCCCATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATTACGGAGGTGGGTTTGAGGATCATGAGCTGCGGGAGGCGCAGAGGGAATATTCAGATTTCCTAGATGATGATCACGATCCCGGCCGTTACCATGGGAAGGTGAGGGACCTGATTGGCTCCAATGACCACCGGCGGATCGTCTCCCTAACTGATGTGATAGTGAGAAAAATGCCTAATTAACCCCCCGGACCCTGAATGATCCCCTCAGAGATTGTGATCCTGCTCTTAATTCAGAAAAAAATCCAAGTGGCTTAACTGATGCTGCCCATCCCGACTTCCGAAACTGCTGACTCCATATCACAGGATTATGCAAAGATCAGGAACCTCTAGCACACCAATACATGATAGTGCCCTGTCACTGCCACTTACTGCCAGAGCGCTGGAAACCGTGATCAGATAGTCTACTGCTCACACTAATCGCAGAATGAGCACAAATTTTGACCGTCCCGATGCTGATACTGCACTTGAGCTGGTCCAGTTTGCCTATTTCTAGAAGGTCCTGCCGAAACAAATTCACCAAAGCCGAACCAGGAGCACGCATGATCGAAACTTAATTCCAGACCCACTTTAACCATAATCGTGTTCGGACCCGTTCCAGGCGTGTCCCGAAAATTGGCTGACCGCCCACATGAATCACGCGGGCCCCGACGCCTTTTTATGCCTGAAAAAAGACGACCTTAAAGGAAAACCCCTTCCCCCACATTCCAGACCCTCCCGGAAAAAGAACCTCCAAATTCAAGAATGCCCNACGAGTGCCCCCTTGTTCAGTAACCAAAAAAAAAAAAATATTTAACAGCTTTCGCATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATTACGGAGGTGGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837701
dbEST ID: 79655403
Trimmed Sequence: GATTAGGAAAACCACATCTTCTGACACCATGACCTGATTGTCATTCTGCATATTGTCCAAGGCCTCCTTTACTTCACTCCGTTCAAAAGGCTCTGGATTCCCCTTGTTGATGAGCTCCAACAGCTGACTGACCGCAACAGACTGTGACCGACTGCTCTTAAAGGCTTTCAGGAGGGCAGCTTTAAACTCTATAGGTCAAGTTATGACTCAAGGACCGCTTGCCATCTTGACTTTCTGCTTTTTTCCGTTGAGGTCTTAAACTCTGAGAAAGGTTTTCATTTAGACTGCTATCTTGCTCACTATAAGACTATGGGTCCATTGAATCATCTAGAGAGTCATCAATTTTTCCTGCACGTCTATAACTTTTCCTAACACTCTCTTGGCTAAGTGTGTCTTGACTTAAGTTTTCATCATGCAGATCCTTGTCTGCTTTTTTCTTCTCATTAGCCAAGACCCTCTTGCAATAGTCAAGCGGGACGACATCATTAGGCGGTTCTCCATCATACCAAACAATGGCTCCGTTTTTTCGTGGAGTAGGAGGGTCACTGGCGAGCCAGACGTCGGCTTAGGCGGTCTCCGAGCTAAACAGCGAGCAGAAGATGCGGAGGGAGGCGGCAGAAGGCGAGGGGGGAGGGGGAGAGGGCGGAGGGAGGGGGGAGGGACGGCGGGGTCGGGAGGGAGGAGAGGGGGAGAAAAGAGAGGAAAGAAAAGGGAAGAGGGGGGGAGGGGGGGGGGTGGGGNCGGTGCGGGNNACGGGGGAGGGGGGGNNGGGNGTANGGAGAGGGGGAGGGGGGCGGGAGGGAGGAAGGGGGGGGGNGAGGGNNGAGAGAGGNAGGAGAGNNNNGGAAAGAGGNGGGGGGAGGGGGGGGAGAAAAAGNANGAGAAGAGAGAGGAAAGANNGGGGAGAGGAGAAAAAAAAAAAAAAAAAAAGGGANNGAGAGGGGGGGGAGGAGGGGGGGGGGGGGGGNGGGGNGNGAGGGGGNGGNGNGGGAAGNGGAAAGAAAGGAAGGANAGAGAGAAGGGNGGGGGNGNNANNGNGGGGNGGNGGGAGNNGGGGAAGGGNGNNANGGGGGGNNNANGNAGAAANGGGGGGNNNNAAANNGGAGNAGGGGGANAGGGGGGAGGGGNNAGGCNGNNGGNGGGGNGGGNNGGGGGGGGGGGCANGGNGNNNNGGNGANNNGG
Full Trace Sequence: GGCCGGGGGAACAGCTATTGACCATGTACAACCGACTCACTACTAGGGGAAACCAGCCTGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATTAGGAAAACCACATCTTCTGACACCATGACCTGATTGTCATTCTGCATATTGTCCAAGGCCTCCTTTACTTCACTCCGTTCAAAAGGCTCTGGATTCCCCTTGTTGATGAGCTCCAACAGCTGACTGACCGCAACAGACTGTGACCGACTGCTCTTAAAGGCTTTCAGGAGGGCAGCTTTAAACTCTATAGGTCAAGTTATGACTCAAGGACCGCTTGCCATCTTGACTTTCTGCTTTTTTCCGTTGAGGTCTTAAACTCTGAGAAAGGTTTTCATTTAGACTGCTATCTTGCTCACTATAAGACTATGGGTCCATTGAATCATCTAGAGAGTCATCAATTTTTCCTGCACGTCTATAACTTTTCCTAACACTCTCTTGGCTAAGTGTGTCTTGACTTAAGTTTTCATCATGCAGATCCTTGTCTGCTTTTTTCTTCTCATTAGCCAAGACCCTCTTGCAATAGTCAAGCGGGACGACATCATTAGGCGGTTCTCCATCATACCAAACAATGGCTCCGTTTTTTCGTGGAGTAGGAGGGTCACTGGCGAGCCAGACGTCGGCTTAGGCGGTCTCCGAGCTAAACAGCGAGCAGAAGATGCGGAGGGAGGCGGCAGAAGGCGAGGGGGGAGGGGGAGAGGGCGGAGGGAGGGGGGAGGGACGGCGGGGTCGGGAGGGAGGAGAGGGGGAGAAAAGAGAGGAAAGAAAAGGGAAGAGGGGGGGAGGGGGGGGGGTGGGGNCGGTGCGGGNNACGGGGGAGGGGGGGNNGGGNGTANGGAGAGGGGGAGGGGGGCGGGAGGGAGGAAGGGGGGGGGNGAGGGNNGAGAGAGGNAGGAGAGNNNNGGAAAGAGGNGGGGGGAGGGGGGGGAGAAAAAGNANGAGAAGAGAGAGGAAAGANNGGGGAGAGGAGAAAAAAAAAAAAAAAAAAAGGGANNGAGAGGGGGGGGAGGAGGGGGGGGGGGGGGGNGGGGNGNGAGGGGGNGGNGNGGGAAGNGGAAAGAAAGGAAGGANAGAGAGAAGGGNGGGGGNGNNANNGNGGGGNGGNGGGAGNNGGGGAAGGGNGNNANGGGGGGNNNANGNAGAAANGGGGGGNNNNAAANNGGAGNAGGGGGANAGGGGGGAGGGGNNAGGCNGNNGGNGGGGNGGGNNGGGGGGGGGGGCANGGNGNNNNGGNGANNNGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATTAGGAAAACCACATCTTCTG