ORFeome > mcm6.2 ORF1 – XORFeome v1.0

mcm6.2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mcm6.2
Gene ID: 6256556
Gene Page ID: 962677
ORF Xenbase ID: 17283441

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044019
Original XGC clone length: 2478

Human orthology & disease relationships

NCBI Entrez ID: 4175
Ensembl gene IDs: ENSG00000076003
Directly associated (OMIM) disease MIM numbers: 223100
Indirectly associated (Lage, et al.) disease MIM numbers: 194050,216400,223100,259500,277700

Library Location

Plate ID: GDExl11016
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ824297
dbEST ID: 79641999
Trimmed Sequence: ATGGACCTGGTAGATCCTTCCCAGAGCGCCGCCGCGGCAGCCGGAACACAACTAGTCAAGGATGAAGTGGCCGAGAAGTGTCAGAAGTTGTTCCAGGATTTCCTGGAGGAGTTTCGGGGTAGCGATGGGGAGTTGAAGTACCAGAGTGATGCAGAGGAACTGATCAGGCCGGAGAGAAATACGCTGCTTGTCAGCTTTGTTGATTTGGAACAGTTTAATCAGCAACTCGCTACCACCATCCAGGAAGAGTTCTATAGGGTGTATCCGTACCTCTGTCGAGCAGTTAAAGCCTTTGCCCGAGATCATGGCAACATTCCACAGAACAAAGAATTCTATGTTGCCTTCCAGGAGCTTCCTACTAGACATAAAATTCGAGAGTTGACTACCCCTCGCATTGGTTCACTGCTGCGGATCAGCGGTCAGGTGGTTCGGACTCACCCAGTCCACCCAGAACTGGTCAGCGGAACCTTTCTTTGCTTGGATTGCCAGACCTTGGTAAGGGATGTAGAGCAGCAGTTTAAATACACACAGCCAAGCATCTGCAGGAATCCAGTGTGCGCCAACAGAAAGAGGTTCATGTTGGATACAAACAAGTCCAGATTTGTTGATTTCCAGAAGGTCCGTATTCAGGAAACGCAGGCAGAGCTTCCAAGAGGCAGCATTCCACAAAGTGTTGAAGTGATCCTGCGAGCTGAAGCTGTGGAATCGTGTCAGGCGGGGGGATAGTGTGACTTCACTGGGATCTCTGGATGGTGTGGCCTGAATTTTCTCGCTCCCCAACCCCCAGGTGGTCGTGCCAAGACCACCTCCCGGGGGGGGGGGGGAAAAAAAAAGGGAGTGA
Full Trace Sequence: AATAATTGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACCTGGTAGATCCTTCCCAGAGCGCCGCCGCGGCAGCCGGAACACAACTAGTCAAGGATGAAGTGGCCGAGAAGTGTCAGAAGTTGTTCCAGGATTTCCTGGAGGAGTTTCGGGGTAGCGATGGGGAGTTGAAGTACCAGAGTGATGCAGAGGAACTGATCAGGCCGGAGAGAAATACGCTGCTTGTCAGCTTTGTTGATTTGGAACAGTTTAATCAGCAACTCGCTACCACCATCCAGGAAGAGTTCTATAGGGTGTATCCGTACCTCTGTCGAGCAGTTAAAGCCTTTGCCCGAGATCATGGCAACATTCCACAGAACAAAGAATTCTATGTTGCCTTCCAGGAGCTTCCTACTAGACATAAAATTCGAGAGTTGACTACCCCTCGCATTGGTTCACTGCTGCGGATCAGCGGTCAGGTGGTTCGGACTCACCCAGTCCACCCAGAACTGGTCAGCGGAACCTTTCTTTGCTTGGATTGCCAGACCTTGGTAAGGGATGTAGAGCAGCAGTTTAAATACACACAGCCAAGCATCTGCAGGAATCCAGTGTGCGCCAACAGAAAGAGGTTCATGTTGGATACAAACAAGTCCAGATTTGTTGATTTCCAGAAGGTCCGTATTCAGGAAACGCAGGCAGAGCTTCCAAGAGGCAGCATTCCACAAAGTGTTGAAGTGATCCTGCGAGCTGAAGCTGTGGAATCGTGTCAGGCGGGGGGATAGTGTGACTTCACTGGGATCTCTGGATGGTGTGGCCTGAATTTTCTCGCTCCCCAACCCCCAGGTGGTCGTGCCAAGACCACCTCCCGGGGGGGGGGGGGAAAAAAAAAGGGAGTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACCTGGTAGATCCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829640
dbEST ID: 79647342
Trimmed Sequence: ATCTTCCAGTATGTAGTTGGGATTAACCACAAGGTAAGGATCCTCTTCTTTTGCTACGTTCTCGTCTTCTGTGCCTTTTAATCCAGTTTGTATGAGCTCAATCAAAATTTGGTCATAGTGCACAAGTCTGTGAATAACTTTGTCAATGATTTGCTTCCTATTAACGAGCTCCTCTTCCGAGTCAATTTCTGACTCAATCTCCTTTAGGTACCAGTTAATGAGTTCACTCTTTCTCTGAGAAGTTTCATTTTCATCATCTTCATCTTCAATCTTCCTCAACTGCAGGACCAGCAAGTTGGAGATCCTTTTGTATTCAGCAAAATTAAGACGCAAAGATGGCTTTGGGGGAGCAGCATTCGTCTCCTCAGCATGCCCATTAATTCCATTTATGTGGCCATTAACACCATTGGGAACATCAGCATCTCCATTAATGCCCTCCTGAGGTTCCTCTACCTCATGTTCATCCTCTTGATCGAGGTTGACATCCGGAGTTTCCACCCTGATGATGGATTTGTTCAATAACCGAAATGCTTCCTTTACATGTTTTGGCTGCACCTCATCACTGCAGTGCATCCTTGCCATGCCTTCAGACAATCTGATCATGCTTTCCAGCTGCCGTACAGTAATCCTCCAAGCAGATTTAGTGACTCCTGAGCCATCTCGCTGCCTCAGTCGCTTGTACGNCCTCCACTATGAAGTCTTCTGACTCCCTTAAAGATCTTTAGGGTTTGAAATTGGCCGGGGCAAAAAAGAAAAAAATCTTCC
Full Trace Sequence: TGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCTTCCAGTATGTAGTTGGGATTAACCACAAGGTAAGGATCCTCTTCTTTTGCTACGTTCTCGTCTTCTGTGCCTTTTAATCCAGTTTGTATGAGCTCAATCAAAATTTGGTCATAGTGCACAAGTCTGTGAATAACTTTGTCAATGATTTGCTTCCTATTAACGAGCTCCTCTTCCGAGTCAATTTCTGACTCAATCTCCTTTAGGTACCAGTTAATGAGTTCACTCTTTCTCTGAGAAGTTTCATTTTCATCATCTTCATCTTCAATCTTCCTCAACTGCAGGACCAGCAAGTTGGAGATCCTTTTGTATTCAGCAAAATTAAGACGCAAAGATGGCTTTGGGGGAGCAGCATTCGTCTCCTCAGCATGCCCATTAATTCCATTTATGTGGCCATTAACACCATTGGGAACATCAGCATCTCCATTAATGCCCTCCTGAGGTTCCTCTACCTCATGTTCATCCTCTTGATCGAGGTTGACATCCGGAGTTTCCACCCTGATGATGGATTTGTTCAATAACCGAAATGCTTCCTTTACATGTTTTGGCTGCACCTCATCACTGCAGTGCATCCTTGCCATGCCTTCAGACAATCTGATCATGCTTTCCAGCTGCCGTACAGTAATCCTCCAAGCAGATTTAGTGACTCCTGAGCCATCTCGCTGCCTCAGTCGCTTGTACGNCCTCCACTATGAAGTCTTCTGACTCCCTTAAAGATCTTTAGGGTTTGAAATTGGCCGGGGCAAAAAAGAAAAAAATCTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTTCCAGTATGTAGTTGGGATT