ORFeome > mcrs1 ORF1 – XORFeome v1.0

mcrs1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mcrs1
Gene ID: 5732662
Gene Page ID: 5732598
ORF Xenbase ID: 17283501

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056006
Original XGC clone length: 1362

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ824513
dbEST ID: 79642215
Trimmed Sequence: ATGATGGATTCTTTGCTAGCTTCCGCTAGTCGCTCTGAGGATGAGGATTCGTCCGCGGGGAATAAAAGGAGTCTGCCTCAAGGATCCGGGCTCGTGCCCAAAAGAAGGAGCTCCTCTAGGTTTATTAAGCGAAAGAAGTTTGATGATGAGTTGGTGGAGAGTAGTCTTGCAAAATCAACCAGTCGTGCCCGTGGTCCTAGTGGAGGGGAACCAGGACGGTATTCTGGCAGTGAGCCTTCCTCCAGTGAGAAAAAGAAGCAAGTCTGTAAAGCAATTTCAACTCCAGCTCCACCATCTCCTGCACCAAGTCCCAGTATCGCTAAACGTATCAAGAAAAGCAAACAACCTCTGCAGGTAACCAAGGATCTGGGAAGATGGAAACCTGCTGATGACCTGCTTCTTATTAACACAGTTTTGCAGACGAACGATCTGCATGCTGTACATCTTGGGGCTAAATTCAGTTGTCGTTTCACTCTGAATGAGATACAAGAACGCTGGTATGCATTGCTGTATGACCCTGTCCTTTCTAAGTTGGCATGTCAGGCTATCCGGCAACTGCACCCAGAAGTCATAGCAGCCATACAGAGCAGGGTTTTGTTCAGTAAAGCTGAAGAGCAACTATTAAGCATAGTAAGCTCGGCCTCTCAGCCTACACTGGACACATTTCAAGGCTTGCTGAAACAGCATCCAGAAAGTTTTCTATATGTCACGTACCCGCTAATCTCCTACAGTCCATTGGCGACTATGAAGCATTATTAATTTGCTGGAAAACAAACAAGTTCGCCACTTCTTAAAGGGGACAAAATTTTAAATTTTTTCAATTGCCAAAAAATCCTTAAAGGAA
Full Trace Sequence: AATTATTGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGGATTCTTTGCTAGCTTCCGCTAGTCGCTCTGAGGATGAGGATTCGTCCGCGGGGAATAAAAGGAGTCTGCCTCAAGGATCCGGGCTCGTGCCCAAAAGAAGGAGCTCCTCTAGGTTTATTAAGCGAAAGAAGTTTGATGATGAGTTGGTGGAGAGTAGTCTTGCAAAATCAACCAGTCGTGCCCGTGGTCCTAGTGGAGGGGAACCAGGACGGTATTCTGGCAGTGAGCCTTCCTCCAGTGAGAAAAAGAAGCAAGTCTGTAAAGCAATTTCAACTCCAGCTCCACCATCTCCTGCACCAAGTCCCAGTATCGCTAAACGTATCAAGAAAAGCAAACAACCTCTGCAGGTAACCAAGGATCTGGGAAGATGGAAACCTGCTGATGACCTGCTTCTTATTAACACAGTTTTGCAGACGAACGATCTGCATGCTGTACATCTTGGGGCTAAATTCAGTTGTCGTTTCACTCTGAATGAGATACAAGAACGCTGGTATGCATTGCTGTATGACCCTGTCCTTTCTAAGTTGGCATGTCAGGCTATCCGGCAACTGCACCCAGAAGTCATAGCAGCCATACAGAGCAGGGTTTTGTTCAGTAAAGCTGAAGAGCAACTATTAAGCATAGTAAGCTCGGCCTCTCAGCCTACACTGGACACATTTCAAGGCTTGCTGAAACAGCATCCAGAAAGTTTTCTATATGTCACGTACCCGCTAATCTCCTACAGTCCATTGGCGACTATGAAGCATTATTAATTTGCTGGAAAACAAACAAGTTCGCCACTTCTTAAAGGGGACAAAATTTTAAATTTTTTCAATTGCCAAAAAATCCTTAAAGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGGATTCTTTGCTAGCTTC

Sequences - 3ʹ (reverse) EST

Accession: JZ829864
dbEST ID: 79647566
Trimmed Sequence: CGACTGGATGACTTTTGCAGCTTCAGCTTTGATCAGAGAGATCAGGTCCTGATTGATAAGGAATACAAATCGGAGACCAGATATCTCTACAACAGAGTTATGACTGAGCTTCCACTTGCTCCCTGGCAGCACTGGCCTTCCATCGATATAAATAGCTCGCCGACCCTCATTGGCTAGGAAGAAGTCTCCATTGTTTTTAAGTTTGATGACACCTTGTTTTCTTGAAATTTTCCATGCCGGGCCTTCCAGAGACAGATCCACGTCAATTTGGTTGTCTTTTGTTGCTCTACCAAGAGTAATCTCTCGAGATCTCATTAGATAGCGCACCATGCGTCCACGTAGCACAGCCAATGTCTGTGTGTCAAAGTCAGGGGAACTCATTCCTGTGATGCTGTCTACTAAAACTTGCCACCGATTCAATTCCTGCTCTAGCTGCCGTATCTCCCTTTTTTGGCGGCGATCAGCAACAGTCAGCTCATGTTCAAGAACTTCATCTCTGGTTTCTCTGAGCTTACTGTCCTCTAGCATGTCTTCTGCATCGGAAAAATTTAAAACTTGATCCCCTTTAGGAAGTGGCTGAACTGTTTGGTCTTCAAGCAAATAATATTGCTTCATAAGTTGCCAATGGACTTGTAGAGATTTAGCGGTACGTGACATATAGAAAAACTTCCTGGATGCTTGTTTCAGCAGCCCTTGAAATGTGTTCCGGTGGAGGGCTGGAGAGG
Full Trace Sequence: GGCAGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGACTGGATGACTTTTGCAGCTTCAGCTTTGATCAGAGAGATCAGGTCCTGATTGATAAGGAATACAAATCGGAGACCAGATATCTCTACAACAGAGTTATGACTGAGCTTCCACTTGCTCCCTGGCAGCACTGGCCTTCCATCGATATAAATAGCTCGCCGACCCTCATTGGCTAGGAAGAAGTCTCCATTGTTTTTAAGTTTGATGACACCTTGTTTTCTTGAAATTTTCCATGCCGGGCCTTCCAGAGACAGATCCACGTCAATTTGGTTGTCTTTTGTTGCTCTACCAAGAGTAATCTCTCGAGATCTCATTAGATAGCGCACCATGCGTCCACGTAGCACAGCCAATGTCTGTGTGTCAAAGTCAGGGGAACTCATTCCTGTGATGCTGTCTACTAAAACTTGCCACCGATTCAATTCCTGCTCTAGCTGCCGTATCTCCCTTTTTTGGCGGCGATCAGCAACAGTCAGCTCATGTTCAAGAACTTCATCTCTGGTTTCTCTGAGCTTACTGTCCTCTAGCATGTCTTCTGCATCGGAAAAATTTAAAACTTGATCCCCTTTAGGAAGTGGCTGAACTGTTTGGTCTTCAAGCAAATAATATTGCTTCATAAGTTGCCAATGGACTTGTAGAGATTTAGCGGTACGTGACATATAGAAAAACTTCCTGGATGCTTGTTTCAGCAGCCCTTGAAATGTGTTCCGGTGGAGGGCTGGAGAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGACTGGATGACTTTTGCAGCTT