ORFeome > mdh2 ORF2 – XORFeome v1.0

mdh2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mdh2
Gene ID: 6251701
Gene Page ID: 971713
ORF Xenbase ID: 17283537

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106695
Original XGC clone length: 1017

Human orthology & disease relationships

NCBI Entrez ID: 4191
Ensembl gene IDs: ENSG00000146701
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102900,115310,150800,171300,248600,252011,256000,266150,266200,312170,600858,605373,605839,606812

Library Location

Plate ID: GDExl11082
Well Location: F09

Sequences - 5ʹ (forward) EST

Accession: JZ837241
dbEST ID: 79654943
Trimmed Sequence: ATGTTCTCTCGCATCGCCAGACCAGCTGCTCATGGGCTCATCCGGGGTCTTTCCACCACTGCACAGGCCAATGCCAGGGTGACAGTGCTTGGTGCTTCAGGAGGAATTGGGCAGCCATTATCCCTGCTGCTTAAGAACAGTCCATTGATTAGCAACCTTGCTTTGTATGATATTGCCCACACACCAGGTGTCGCAGCTGATCTGAGCCACATTGAGACTAGAGCAAAGGTTACAGGTTATCTTGGAGCAGAACAGCTTCCTGAAAGTCTCAAGAGTGCTGATGTTGTTGTTATTCCAGCCGGTGTGCCAAGGAAACCAGGTATGACCCGTGATGATCTGTTTAACACTAATGCTTCCATTGTGGCCACCCTGACTGATGCATGTGCAAAGCATTGCCCAGAAGCAATGATCTGTATCATTTCCAACCCTGTAAATTCAACTATCCCAATCACATCAGAAGTGTTTAAAAAACATGGTGTTTACAACCCCAACCGCATTTTTGGTGTAACCACATTGGATATTGTTAGAGCCAATACCTTTGTTGCTGAGCTCAAGGGCTTGGACCCAGCACGTGTGAATGTGCCAGTGATTGGTGGACATGCTGGCAAAACAATTATTCCCTTTATTTCTCAAAACACACCAAAAATAAATTTTCCCCAAGAACCCCCTGGAAGTACTGAATTGGCCGAAATTCAAGAAGCCGGGTAAAAAAGGTTGTCAAGGCTAAAGCAAAGAACAAGAATGCACCACCCCCTTTCCCTGGCCATATTCGCTGAAGACCCAAAATTAATCTTTTTCCCCCCCCTTGTATTCCTATACAAAAAGGAA
Full Trace Sequence: GGGGGCCCATATAATAGATTTTATTTNTGACTGATAGTGACCTGNTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCTCTCGCATCGCCAGACCAGCTGCTCATGGGCTCATCCGGGGTCTTTCCACCACTGCACAGGCCAATGCCAGGGTGACAGTGCTTGGTGCTTCAGGAGGAATTGGGCAGCCATTATCCCTGCTGCTTAAGAACAGTCCATTGATTAGCAACCTTGCTTTGTATGATATTGCCCACACACCAGGTGTCGCAGCTGATCTGAGCCACATTGAGACTAGAGCAAAGGTTACAGGTTATCTTGGAGCAGAACAGCTTCCTGAAAGTCTCAAGAGTGCTGATGTTGTTGTTATTCCAGCCGGTGTGCCAAGGAAACCAGGTATGACCCGTGATGATCTGTTTAACACTAATGCTTCCATTGTGGCCACCCTGACTGATGCATGTGCAAAGCATTGCCCAGAAGCAATGATCTGTATCATTTCCAACCCTGTAAATTCAACTATCCCAATCACATCAGAAGTGTTTAAAAAACATGGTGTTTACAACCCCAACCGCATTTTTGGTGTAACCACATTGGATATTGTTAGAGCCAATACCTTTGTTGCTGAGCTCAAGGGCTTGGACCCAGCACGTGTGAATGTGCCAGTGATTGGTGGACATGCTGGCAAAACAATTATTCCCTTTATTTCTCAAAACACACCAAAAATAAATTTTCCCCAAGAACCCCCTGGAAGTACTGAATTGGCCGAAATTCAAGAAGCCGGGTAAAAAAGGTTGTCAAGGCTAAAGCAAAGAACAAGAATGCACCACCCCCTTTCCCTGGCCATATTCGCTGAAGACCCAAAATTAATCTTTTTCCCCCCCCTTGTATTCCTATACAAAAAGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCTCTCGCATCGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837240
dbEST ID: 79654942
Trimmed Sequence: CTTCCGGCTCTTGATGAATTCTTCACCCTTTTTAATGGAGCCTTTTAGTTCTGCCATGGCTTCTGAAACCAGTTTCTCCTCATAAGCAGTCAGCTTGCCTAGTCCCAGATTCTTCTCAATGCCATTTTTCCCCAGCAGCAGAGGAGTTGAGAAGTAAGGGCTCTCAGTTTCCTCAGACCTGACAAATGAGCACTCAATCACACCTTCCTTTCCATTCATAGCATCCAGGAGGGAAAAGACAAATCGGGCTCCAGCATATGCCATGGAAAGAGTGGCTGATCCTGCTCCTGCTTTAGCCTTGACAACCTCTGTACCAGCCTCTTGAATTCGGCCAATCAGTACTTCCAGCTGGTCTTGGGGAAACTCTACTTTTGGTGTGCTCTGAGAAATAAGAGGAATAATTGTTTTGCCAGCATGTCCACCAATCACAGGCACATTCACACGTGCTGGGTCCAAGCCCTTGAGCTCAGCAACAAAGGTATTGGCTCTAACAATATCCAATGTGGTTACACCAAAAATGCGGTTGGGGTTGTAAACACCATGTTTTTTAAACACTTCTCATGTGATTAGGAAAAGTTGAATTTACAAGGGTTGGAAATGAGAACAGATCATTGCTTCTGGGCCATGCTTTGCACATGCATCCGTTCAGGGTGCCCCCAAGGAAAACCATTGGTGTTTATCAAGATCATACACGGGTCAAACCCTGGGTTTCCCTTTGTCGACACGGGCGTGGAAT
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCCGGCTCTTGATGAATTCTTCACCCTTTTTAATGGAGCCTTTTAGTTCTGCCATGGCTTCTGAAACCAGTTTCTCCTCATAAGCAGTCAGCTTGCCTAGTCCCAGATTCTTCTCAATGCCATTTTTCCCCAGCAGCAGAGGAGTTGAGAAGTAAGGGCTCTCAGTTTCCTCAGACCTGACAAATGAGCACTCAATCACACCTTCCTTTCCATTCATAGCATCCAGGAGGGAAAAGACAAATCGGGCTCCAGCATATGCCATGGAAAGAGTGGCTGATCCTGCTCCTGCTTTAGCCTTGACAACCTCTGTACCAGCCTCTTGAATTCGGCCAATCAGTACTTCCAGCTGGTCTTGGGGAAACTCTACTTTTGGTGTGCTCTGAGAAATAAGAGGAATAATTGTTTTGCCAGCATGTCCACCAATCACAGGCACATTCACACGTGCTGGGTCCAAGCCCTTGAGCTCAGCAACAAAGGTATTGGCTCTAACAATATCCAATGTGGTTACACCAAAAATGCGGTTGGGGTTGTAAACACCATGTTTTTTAAACACTTCTCATGTGATTAGGAAAAGTTGAATTTACAAGGGTTGGAAATGAGAACAGATCATTGCTTCTGGGCCATGCTTTGCACATGCATCCGTTCAGGGTGCCCCCAAGGAAAACCATTGGTGTTTATCAAGATCATACACGGGTCAAACCCTGGGTTTCCCTTTGTCGACACGGGCGTGGAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCCGGCTCTTGATGAATTCT