ORFeome > mdk ORF2 – XORFeome v1.0

mdk ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mdk
Gene ID: 488506
Gene Page ID: 488501
ORF Xenbase ID: 17283549

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108811
Original XGC clone length: 429

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ837659
dbEST ID: 79655361
Trimmed Sequence: ATGGAATTACGAGCATTTTGTGTCATTCTCTTGATCACAGTCCTGGCCGTGAGTTCACAAGCAGCAAAGAACAAAAAAGAGAAGGGTAAGAAGGGGGCGTCAGACTGCACAGAGTGGACCTGGGGGAGCTGTATCCCCAACAGCAAAGACTGCGGAGCTGGAACTCGGGAGGGAACATGCAAAGAGGAGACCCGTAAGCTGAAGTGCAAGATTCCCTGCAACTGGAAGAAAGCCTTTGGGGCTGATTGCAAGTACAAATTTGAGAACTGGGGAGAGTGCAATGCCACCACTGGCCAGAAGGTGCGCTCTGGAACCCTAAAGAAGGCTCTGTATAATGCCGACTGCCAGCAAACCGTGGAAGCCACCAAGCCCTGCTCCCTGAAAACCAAGTCCAAATCCAAAGGCAAGAAAGGCAAAGGGAAGGAGTT
Full Trace Sequence: TCGCGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAATTACGAGCATTTTGTGTCATTCTCTTGATCACAGTCCTGGCCGTGAGTTCACAAGCAGCAAAGAACAAAAAAGAGAAGGGTAAGAAGGGGGCGTCAGACTGCACAGAGTGGACCTGGGGGAGCTGTATCCCCAACAGCAAAGACTGCGGAGCTGGAACTCGGGAGGGAACATGCAAAGAGGAGACCCGTAAGCTGAAGTGCAAGATTCCCTGCAACTGGAAGAAAGCCTTTGGGGCTGATTGCAAGTACAAATTTGAGAACTGGGGAGAGTGCAATGCCACCACTGGCCAGAAGGTGCGCTCTGGAACCCTAAAGAAGGCTCTGTATAATGCCGACTGCCAGCAAACCGTGGAAGCCACCAAGCCCTGCTCCCTGAAAACCAAGTCCAAATCCAAAGGCAAGAAAGGCAAAGGGAAGGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTAAAAGAAAAAGAAAAAAATCTAATAATGTTACATCTGGAGAGGGACCGGGGAGGAAAGTGCCAAAATTTACGGGCTCCCCCAGAATACGGGGGGGCCCCCACAAAAAAAACGGTGGAGGGGGAAAAAACCCCGGGGAAAAAAACCCCCGTTCGGGGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAATTACGAGCATTTTGTGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ837658
dbEST ID: 79655360
Trimmed Sequence: CTCCTTCCCTTTGCCTTTCTTGCCTTTGGATTTGGACTTGGTTTTCAGGGAGCAGGGCTTGGTGGCTTCCACGGTTTGCTGGCAGTCGGCATTATACAGAGCCTTCTTTAGGGTTCCAGAGCGCACCTTCTGGCCAGTGGTGGCATTGCACTCTCCCCAGTTCTCAAATTTGTACTTGCAATCAGCCCCAAAGGCTTTCTTCCAGTTGCAGGGAATCTTGCACTTCAGCTTACGGGTCTCCTCTTTGCATGTTCCCTCCCGAGTTCCAGCTCCGCAGTCTTTGCTGTTGGGGATACAGCTCCCCCAGGTCCACTCTGTGCAGTCTGACGCCCCCTTCTTACCCTTCTCTTTTTTGTTCTTTGCTGCTTGTGAACTCACGGCCAGGACTGTGATCAAGAGAATGACACAAAATGCTCGTAATTCCATGG
Full Trace Sequence: GGCCAGGGGATCAGCTTATGACCATGGTAATACGACTCCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCCTTCCCTTTGCCTTTCTTGCCTTTGGATTTGGACTTGGTTTTCAGGGAGCAGGGCTTGGTGGCTTCCACGGTTTGCTGGCAGTCGGCATTATACAGAGCCTTCTTTAGGGTTCCAGAGCGCACCTTCTGGCCAGTGGTGGCATTGCACTCTCCCCAGTTCTCAAATTTGTACTTGCAATCAGCCCCAAAGGCTTTCTTCCAGTTGCAGGGAATCTTGCACTTCAGCTTACGGGTCTCCTCTTTGCATGTTCCCTCCCGAGTTCCAGCTCCGCAGTCTTTGCTGTTGGGGATACAGCTCCCCCAGGTCCACTCTGTGCAGTCTGACGCCCCCTTCTTACCCTTCTCTTTTTTGTTCTTTGCTGCTTGTGAACTCACGGCCAGGACTGTGATCAAGAGAATGACACAAAATGCTCGTAATTCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAAACTGAAAAACATTTTACAACTCGTGACTGGCAATAAGCACCCCGAAGGATAAAGCACAACTAAAGGTTACCCAAAAAAGGGGGAAAACAATCTCTTGGTTGTGTGGAGTGGAAGAAACCAGGAAAAAAAAAAATCTCGGGGAGCAGATTGTAAGTTGGAAAAGAAGGGGGCTCCCGCTTGGTCCGAAATTGGACGAAAACAACAGGGGTAAGGAGGGAGAGGGGGGTTCCCGGGGGGGTGAAAAATGTTTTTGGGGGGGTCCACCACCCCGCGGGGAGCAACGAAAAGGCGGTGTTCGGTGGGGGGAGGGGGGGGGTTTGTGGATAGGGAAAATATATAGAAGGGGGGGGCGCCCCGCGAGAAGAGAAAAAAAAGGGGGGGGCAAGGGGAGAGGGGAAGTAGTGGTCAAGAGAGGAGGANGNGGGTGCGAGGTAGAAGCAGCCACAGGGAGGGAGAGGGGGAGGGGCGCCGGAGTGAGAGGACCACGAAAAAAGAGAAGNNAAAGAGGGAGGAGAGGGAAGAAGGAACAGAGCTTTAGAGAGGNAGGGAGGAGGAAGGAGGGGAGNGGGAAGGAAGACGAGCGGAGGAGCGTGAATGGTGGGNAGGGCACCTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCTTCCCTTTGCCTTT