ORFeome > med29 ORF1 – XORFeome v1.0

med29 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: med29
Gene ID: 6254344
Gene Page ID: 1006667
ORF Xenbase ID: 17283663

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078525
Original XGC clone length: 561

Human orthology & disease relationships

NCBI Entrez ID: 55588
Ensembl gene IDs: ENSG00000063322
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 214400,607706,607831,608340

Library Location

Plate ID: GDExl11005
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ839804
dbEST ID: 79657506
Trimmed Sequence: ATGGCGATGTTGCTGAACCAGGCTCAGCCTCCCCAGACTCGGGACGGTGGCGGAACGCAAGGCGCTTCCCTTGGCCCTGGGGTTCCAGTTGGGCAACAGCAGCTCGGCCTTCAGCAACAACAGCAGGATTTTGACCCGGTGCAAAGATACAGGATGCTTATCCCTCAGTTGAAGGAAAGTCTGCAGAACCTCATGAAGATAGCAGCCCAGAACCTTGCGCAGAACACAAACATTGATAATGGCCAGAAAAGTGCAGATGGGCCAGTGCAGAGGTTTGACAAAAGCCTGGAGGAGTTTTATGCCCTATGTGACCAAATGGAGCTTTGTCTACGACTTGCCTACGAGTGCCTCTCCCAGAGCTATGACAGCGCAAAGCATTCACCTACATTGGTGCCTACAGCCACTAAACCTGATGCAGTACAGACCGAAAGCCTACCTTATACCCAGTATTTGAGCATGATCAAATCACAGATATCTTGTGCCAAAGACATACACAATGCACTTCTTGAGTGTTCGAAAAAGATAATGGGAAAGACTCCGAACACACAAGGTGGACTTTT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGATGTTGCTGAACCAGGCTCAGCCTCCCCAGACTCGGGACGGTGGCGGAACGCAAGGCGCTTCCCTTGGCCCTGGGGTTCCAGTTGGGCAACAGCAGCTCGGCCTTCAGCAACAACAGCAGGATTTTGACCCGGTGCAAAGATACAGGATGCTTATCCCTCAGTTGAAGGAAAGTCTGCAGAACCTCATGAAGATAGCAGCCCAGAACCTTGCGCAGAACACAAACATTGATAATGGCCAGAAAAGTGCAGATGGGCCAGTGCAGAGGTTTGACAAAAGCCTGGAGGAGTTTTATGCCCTATGTGACCAAATGGAGCTTTGTCTACGACTTGCCTACGAGTGCCTCTCCCAGAGCTATGACAGCGCAAAGCATTCACCTACATTGGTGCCTACAGCCACTAAACCTGATGCAGTACAGACCGAAAGCCTACCTTATACCCAGTATTTGAGCATGATCAAATCACAGATATCTTGTGCCAAAGACATACACAATGCACTTCTTGAGTGTTCGAAAAAGATAATGGGAAAGACTCCGAACACACAAGGTGGACTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAATCATTATTTGCCATCCACCTGATATCCCCTATAGTGAATTCTATTACAATGGGTCATAAAAAGTTTACAGGGAAACCTCTGGCCCGTGTCTCAACAATCCCTTTAAAAAATTAAAAAAAAANNNNNNNNTTNNT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGATGTTGCTGAACCAGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839803
dbEST ID: 79657505
Trimmed Sequence: AAGTCCACCTTGTGTGTTCGGAGTCTTTCCCATTATCTTTTTCGAACACTCAAGAAGTGCATTGTGTATGTCTTTGGCACAAGATATCTGTGATTTGATCATGCTCAAATACTGGGTATAAGGTAGGCTTTCGGTCTGTACTGCATCAGGTTTAGTGGCTGTAGGCACCAATGTAGGTGAATGCTTTGCGCTGTCATAGCTCTGGGAGAGGCACTCGTAGGCAAGTCGTAGACAAAGCTCCATTTGGTCACATAGGGCATAAAACTCCTCCAGGCTTTTGTCAAACCTCTGCACTGGCCCATCTGCACTTTTCTGGCCATTATCAATGTTTGTGTTCTGCGCAAGGTTCTGGGCTGCTATCTTCATGAGGTTCTGCAGACTTTCCTTCAACTGAGGGATAAGCATCCTGTATCTTTGCACCGGGTCAAAATCCTGCTGTTGTTGCTGAANGCCGAGCTGCTGTTGCCCAACTGGAACCCCAGGGCCAAGGGAAGCGCCTTGCGTTCCGCCACCGTCCCGAGTCTGGGGAGGCTGAGCCTGGTTCGCAACATCGCCCTGG
Full Trace Sequence: GGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGTCCACCTTGTGTGTTCGGAGTCTTTCCCATTATCTTTTTCGAACACTCAAGAAGTGCATTGTGTATGTCTTTGGCACAAGATATCTGTGATTTGATCATGCTCAAATACTGGGTATAAGGTAGGCTTTCGGTCTGTACTGCATCAGGTTTAGTGGCTGTAGGCACCAATGTAGGTGAATGCTTTGCGCTGTCATAGCTCTGGGAGAGGCACTCGTAGGCAAGTCGTAGACAAAGCTCCATTTGGTCACATAGGGCATAAAACTCCTCCAGGCTTTTGTCAAACCTCTGCACTGGCCCATCTGCACTTTTCTGGCCATTATCAATGTTTGTGTTCTGCGCAAGGTTCTGGGCTGCTATCTTCATGAGGTTCTGCAGACTTTCCTTCAACTGAGGGATAAGCATCCTGTATCTTTGCACCGGGTCAAAATCCTGCTGTTGTTGCTGAANGCCGAGCTGCTGTTGCCCAACTGGAACCCCAGGGCCAAGGGAAGCGCCTTGCGTTCCGCCACCGTCCCGAGTCTGGGGAGGCTGAGCCTGGTTCGCAACATCGCCCTGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCAATTTGTTGCAACGAACAAGTCACTAACAATCAAATAAAATCCATTTAATTTGGGGACCCAAACTTAAAACTGGCCTCATAAAATTTGGCATGCCTGCTGGGGGGGAAAAAAAAAAAAAAAAAGAGAAGAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGTCCACCTTGTGTGTTC