ORFeome > med30 ORF1 – XORFeome v1.0

med30 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: med30
Gene ID: 1008117
Gene Page ID: 1008111
ORF Xenbase ID: 17283669

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123139
Original XGC clone length: 555

Human orthology & disease relationships

NCBI Entrez ID: 90390
Ensembl gene IDs: ENSG00000164758
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 154500,253300,253400,253550,600334,603689,604145,608807,608808

Library Location

Plate ID: GDExl11087
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CCTGGGGGCCCCAATAAGGATTTTATTTTGACTGATANTGACCTGNTTCNTTGCAACAAATTGATGAGCAATGCTTTTTTAAATGCCAACTTTGTAAAAAAAGTTGGCACCATGTCGACCCCTCCCTTGTCAAGTCCTGGGATGGGAACCGCCGCCGGGCCCGGGGGTTTTCCTGGAACACAACCAACCCACGCGGCCTCTGAAATGAAAACCGCAACCCCTGTGTTCAACCGGCAAAAAAATGTTTCAGAAAATTTATTTCCGAAAAAGGAAAATCTTCCCACCTGCCCCCAAAAACGGCATTTCCCCAGGGGGGTTCCCTAAAAAAAAGGTCACCCAACAAAGAAAAAAAAGGGGCAAAATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGACCCCTCCCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838051
dbEST ID: 79655753
Trimmed Sequence: GTTCCTCATCGCCAGCATTGAGTTGATGTCCCAGATAAGGTTCCTTAACTGATCCATGATCTGCTTCAGTTGCTGATTCTTTTGTTTCAGTTTCTTGTTAACTTCCAGAATTTCTCTTTTTTCCTCACTTGCAAAGCGTAGTTGGCTGGCAATGCCCCGGTCATCGTGCTTGGAATATTCTTCTTCCACATACGGTATGAGCTGCTCTATAGGTACAGGGTCCAGTCCAGCACAGTTCTCATTGCACTTGTCATAGACCAGCCTCAGCTTGCGGAACAGGATTGAAAGCTGCCGGAGATGCTCTTGCAACTTGCCCAGTCTGTCCTGGTAGGTGACCGTGTGATAGGTGACCCCATTGGGTAACTGCATGTTACGGAGCAGCTGGAAGATCTCCATAGTCCGGAATACAATGTCCTGAACAGTCTCTTGGCCGATGCGACACAGGGATGCGGTGTTCACTTCACGAGCCGCGGTGGCTGCTTGTGCTCCAGGGAAACCCCCCCGCCCGGCCGCCCCTCCCATCCCCAGACCTGAAAAGGGAAGGGTCGACATGG
Full Trace Sequence: GTGCATTATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTCCTCATCGCCAGCATTGAGTTGATGTCCCAGATAAGGTTCCTTAACTGATCCATGATCTGCTTCAGTTGCTGATTCTTTTGTTTCAGTTTCTTGTTAACTTCCAGAATTTCTCTTTTTTCCTCACTTGCAAAGCGTAGTTGGCTGGCAATGCCCCGGTCATCGTGCTTGGAATATTCTTCTTCCACATACGGTATGAGCTGCTCTATAGGTACAGGGTCCAGTCCAGCACAGTTCTCATTGCACTTGTCATAGACCAGCCTCAGCTTGCGGAACAGGATTGAAAGCTGCCGGAGATGCTCTTGCAACTTGCCCAGTCTGTCCTGGTAGGTGACCGTGTGATAGGTGACCCCATTGGGTAACTGCATGTTACGGAGCAGCTGGAAGATCTCCATAGTCCGGAATACAATGTCCTGAACAGTCTCTTGGCCGATGCGACACAGGGATGCGGTGTTCACTTCACGAGCCGCGGTGGCTGCTTGTGCTCCAGGGAAACCCCCCCGCCCGGCCGCCCCTCCCATCCCCAGACCTGAAAAGGGAAGGGTCGACATGGTGCCAACTTTTTTTGACAAAGTTGGCATTTAAAAAAAACATTGCTCATCAATTTGTTGCAACCAAAAGGTTACTATCAATCAAAAAAAAAATCATTTATTTGGGGCCCCAACTTTTAGAAGGGCCCGCCCATTTTTACAAAGAATAAAAAAAAAGAAAGAAAAAAAAGAGCGACGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTCCTCATCGCCAGCA