ORFeome > mef2a ORF1 – XORFeome v1.0

mef2a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mef2a
Gene ID: 487398
Gene Page ID: 487393
ORF Xenbase ID: 17283711

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046368
Original XGC clone length: 1551

Human orthology & disease relationships

NCBI Entrez ID: 4205
Ensembl gene IDs: ENSG00000068305
Directly associated (OMIM) disease MIM numbers: 608320
Indirectly associated (Lage, et al.) disease MIM numbers: 126600,145260,216400,278780,608320

Library Location

Plate ID: GDExl11011
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: JZ823884
dbEST ID: 79641586
Trimmed Sequence: ATGGGAAGGAAGAAAATACAAATTACGCGGATAATGGACGAACGAAACAGACAGGTAACATTTACCAAGAGAAAGTTTGGACTGATGAAGAAGGCTTACGAACTGAGCGTACTCTGTGACTGTGAAATTGCACTGATTATTTTCAATAGCTCTAACAAGCTGTTTCAATATGCCAGTACGGACATGGACAAAGTCCTTCTCAAGTACACCGAATACAATGAGCCCCATGAGAGCAGAACCAACTCTGACATTGTTGAGACTCTCAGAAAGAAAGGCTTAAATGGTTGTGAAAGCCCAGATGATCAGAGATACTTTGAGGAGGAGACATTCAGCAAACTAATTGAAGATAGTGATTTTGTTTTCAAGCGAGACCCTGCACTGAACAAGAAGGAAAACAGAGGTTGTGACAGCCCGGACCCTGATGGCTCCTACGTACTCACCCCCCACACCGAGGAAAAGTACAAAAAAATTAACGAGGAATTTGATAATATGATGCGCAGTCATAAAATCTCACCTGGATTACCACAGCAAACCTTTCCAATGTCTGTCACTGTACCGGTGTCCAACCCAAACACATTAACGTACAGTTCTCCAGGGAACACAATGGTTACTGCTTCATTAGCTGCCAGTGCATCATTAACAGATGCAAGAATGCTGTCCCCACCTCCNACGACCTGCATCGNAANTGTGGGTTTCCCAGGGCTACCCCAGCGGCCTCCTAGCACGGAATGCTGGGGGTAATGTTTGGGTCCGCCTGGACTCTTCGTGCCCAAATGGAGCAAGGTCCATTCCGCAAGGGGTAAAGGGGTTTGTAACCCCCCCCCCCTTTCCCAACCCCCT
Full Trace Sequence: ATTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAAGGAAGAAAATACAAATTACGCGGATAATGGACGAACGAAACAGACAGGTAACATTTACCAAGAGAAAGTTTGGACTGATGAAGAAGGCTTACGAACTGAGCGTACTCTGTGACTGTGAAATTGCACTGATTATTTTCAATAGCTCTAACAAGCTGTTTCAATATGCCAGTACGGACATGGACAAAGTCCTTCTCAAGTACACCGAATACAATGAGCCCCATGAGAGCAGAACCAACTCTGACATTGTTGAGACTCTCAGAAAGAAAGGCTTAAATGGTTGTGAAAGCCCAGATGATCAGAGATACTTTGAGGAGGAGACATTCAGCAAACTAATTGAAGATAGTGATTTTGTTTTCAAGCGAGACCCTGCACTGAACAAGAAGGAAAACAGAGGTTGTGACAGCCCGGACCCTGATGGCTCCTACGTACTCACCCCCCACACCGAGGAAAAGTACAAAAAAATTAACGAGGAATTTGATAATATGATGCGCAGTCATAAAATCTCACCTGGATTACCACAGCAAACCTTTCCAATGTCTGTCACTGTACCGGTGTCCAACCCAAACACATTAACGTACAGTTCTCCAGGGAACACAATGGTTACTGCTTCATTAGCTGCCAGTGCATCATTAACAGATGCAAGAATGCTGTCCCCACCTCCNACGACCTGCATCGNAANTGTGGGTTTCCCAGGGCTACCCCAGCGGCCTCCTAGCACGGAATGCTGGGGGTAATGTTTGGGTCCGCCTGGACTCTTCGTGCCCAAATGGAGCAAGGTCCATTCCGCAAGGGGTAAAGGGGTTTGTAACCCCCCCCCCCTTTCCCAACCCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAGGAAGAAAATACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829193
dbEST ID: 79646895
Trimmed Sequence: TGTCACCCAAGCATCCATCCTCATGCGTTTCACAGAGGGGCTGTCCCTGTCCTCGTTATTGGCAGGTCTTCCCAAGCCAATCGGTGAATGAAAGTCATTTCTGACGTCCTCTCGGTCGCTGCCATCATAGGAACTGCTGGAGCTGCTCAGGCTGTCCATTTCTGGGCGAGGTTGGTGTTGGTGGTGCTGATGGGATTGAAATCCAGAAGGAGTGATCCTATCACGGGGGGGTGATATGGGCTCGGACTTTATATTGATGTTCTGGTTTGTGTTGATGGACAAATTAGAACCCTGAGATAATTGTCCAGTAGCCACAAAGGAGCTGAGGGCTGCTTGTCCTACGTGATGCTGTTGCCAGGCTGAAACCTGTCCTAGAGGCAATATTCCTGGGGAGTTAAACCCCTGCAGCATTGACAGATCTGCACTGGTCAAAGGATAGTCTGTATTGTAGGCAGTAGGCATTGCAGAATAAATCAGCCCCTGAGGGGCTAAACTGGGAGTAGCTACTGAAACAATTGGGGTGGCAAGTGGCTGAGTACCTTGTGAACTGGTTACTCTTTTGGTGTTCAAAGGAGGCATCATGCCTTTTCTGGAAGGAGGAATAACAACACGTAGGTTAGGTTTTTCGGCTGTTCATAACAAGGTTCCCTCCAGGGGGTGGGGGGAAAATTTTGAAAGGCATCACTTTT
Full Trace Sequence: CTGCCAGGAAGCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTCACCCAAGCATCCATCCTCATGCGTTTCACAGAGGGGCTGTCCCTGTCCTCGTTATTGGCAGGTCTTCCCAAGCCAATCGGTGAATGAAAGTCATTTCTGACGTCCTCTCGGTCGCTGCCATCATAGGAACTGCTGGAGCTGCTCAGGCTGTCCATTTCTGGGCGAGGTTGGTGTTGGTGGTGCTGATGGGATTGAAATCCAGAAGGAGTGATCCTATCACGGGGGGGTGATATGGGCTCGGACTTTATATTGATGTTCTGGTTTGTGTTGATGGACAAATTAGAACCCTGAGATAATTGTCCAGTAGCCACAAAGGAGCTGAGGGCTGCTTGTCCTACGTGATGCTGTTGCCAGGCTGAAACCTGTCCTAGAGGCAATATTCCTGGGGAGTTAAACCCCTGCAGCATTGACAGATCTGCACTGGTCAAAGGATAGTCTGTATTGTAGGCAGTAGGCATTGCAGAATAAATCAGCCCCTGAGGGGCTAAACTGGGAGTAGCTACTGAAACAATTGGGGTGGCAAGTGGCTGAGTACCTTGTGAACTGGTTACTCTTTTGGTGTTCAAAGGAGGCATCATGCCTTTTCTGGAAGGAGGAATAACAACACGTAGGTTAGGTTTTTCGGCTGTTCATAACAAGGTTCCCTCCAGGGGGTGGGGGGAAAATTTTGAAAGGCATCACTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTCACCCAAGCATCCAT