ORFeome > meig1 ORF1 – XORFeome v1.0

meig1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: meig1
Gene ID: 6255168
Gene Page ID: 972495
ORF Xenbase ID: 17283729

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059980
Original XGC clone length: 267

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ824482
dbEST ID: 79642184
Trimmed Sequence: ATGTCTGCCTCTGAAGCAAAACCAAAGTCAATGACTCGTGCAAAACAATGGTCAGATGAGATAGAAAATTTGTACAGGTTTCAGACTGCTGGATACAGAGATGAAGTGGAATACAGGCATGTAAAGCAAGTTGAAATGGTGGATCGATGGCCTGAAACTGGATTTGTGAAAAAACTTCAAAGAAAGGATAATACGTTTTACTATTACAATAAAAAGAGAGAATGTGAAGAAAAAGAAGTCAATAAAGTTAAAGTATATGCCTATTT
Full Trace Sequence: GGGGGAGCGTCACTATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGCCTCTGAAGCAAAACCAAAGTCAATGACTCGTGCAAAACAATGGTCAGATGAGATAGAAAATTTGTACAGGTTTCAGACTGCTGGATACAGAGATGAAGTGGAATACAGGCATGTAAAGCAAGTTGAAATGGTGGATCGATGGCCTGAAACTGGATTTGTGAAAAAACTTCAAAGAAAGGATAATACGTTTTACTATTACAATAAAAAGAGAGAATGTGAAGAAAAAGAAGTCAATAAAGTTAAAGTATATGCCTATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCGGGTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCATAATCTCTAATGATACATGATAGAGTTTCTGTCTTTTCTACTGCTTCGACCTGCAGACTGCCTGTGTATAAGGGAGCCTGACTTTTATATTCCCCAGAACATCAGGTTAATGGCGTATTTGATGTCATTGTCGCGGCGGCCGACATCACCCACTTCATTCCCCGATTACGGAAAACCGGCCACTGGCCATATCGGTGGTCACCATGCGCCACCCTTTAACCCCCGACAAGCACCACCGGGGTAAAGTTTACCGGGAGACCTTTAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGCCTCTGAAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829836
dbEST ID: 79647538
Trimmed Sequence: ATAGGCATATACTTTAACTTTATTGACTTCTTTTTCTTCACATTCTCTCTTTTTATTGTAATAGTAAAACGTATTATCCTTTCTTTGAAGTTTTTTCACAAATCCAGTTTCAGGCCATCGATCCACCATTTCAACTTGCTTTACATGCCTGTATTCCACTTCATCTCTGTATCCAGCAGTCTGAAACCTGTACAAATTTTCTATCTCATCTGACCATTGTTTTGCACGAGTCATTGACTTTGGTTTTGCTTCAGAGGCAGACATGG
Full Trace Sequence: AAGTCTGCAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAGGCATATACTTTAACTTTATTGACTTCTTTTTCTTCACATTCTCTCTTTTTATTGTAATAGTAAAACGTATTATCCTTTCTTTGAAGTTTTTTCACAAATCCAGTTTCAGGCCATCGATCCACCATTTCAACTTGCTTTACATGCCTGTATTCCACTTCATCTCTGTATCCAGCAGTCTGAAACCTGTACAAATTTTCTATCTCATCTGACCATTGTTTTGCACGAGTCATTGACTTTGGTTTTGCTTCAGAGGCAGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAGACTGAAAGTCATTTTACAACATCGCTGACTGGGATGTCTCTTGGGCTTCCTAAAAAAGATTGTCATCCCTTGCAGTCATTCAAAAGAAAATACTATAACCATCACGATTCGGCTCCATTTTACGGGCATTATTACAAACTTAAATAGAAATAGGCTCATGTTTGATCGGGACATCAGTCTTTTAACCTCACCCCTGTAAAAAGCGCAAATACGCTAACCCGCTATGGGCAAGGAAAAGAACGGGGAACTGGAGGAAATCGTGATGTGTCAACACCCATAAATAACCCACATTTCCCTTTTGAGGACAAACAAAAAAACTTTTTTCCCTCCACCCCTGAAAGTTTTAAAAACCATATAACCGAAATTTACCCGGAGGAGTCTTTCAATCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAGGCATATACTTTAACTTTATT