ORFeome > meis3 ORF3 – XORFeome v1.0

meis3 ORF3 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: meis3
Gene ID: 6252025
Gene Page ID: 485336
ORF Xenbase ID: 17283747

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084920
Original XGC clone length: 1362

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11068
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ834684
dbEST ID: 79652386
Trimmed Sequence: ATGGCACAAAGGTATGATGAGATGCTGCATTACCCAACGTTGGATGGGATGCCTCTGGCAGGATTTGGGGATGCACACACAGGCCGAGCACTACAGCACCACTCACTTAGCCAGAGTGCACCCTATGGATCTACAGGAGCAGGTCACCGAGTACCAATGCCCCCTGGAATGGGCAGCAACGATGGTCTGAAAAGAGAGAAGGATGAGATTTATGGGCACCCACTGTTTCCTCTGCTGGCTTTGGTGTTCGAGAAGTGCGAACTGGCTACGTGTTCCCCTCGTGACAATTCAGGGTCATTCCCAGGGGGCGATGTTTGCTCTTCAGATTCTTTTAATGAAGATATTGCTGTTTTTGCCAAACAGGTCAGAACAGAAAAACCCCTGTTCTCTTCCAACCCAGAGCTGGACAGTTTGATGATTCAAGCCATTCAAGTTTTACGATTCCACCTGTTGGAGTTAGAAAAGGTTCATGATCTGTGTGACAATTTCTGCCACCGGTATATCACATGTCTAAAAGGCAAGATGCCCATTGATTTAGTGATAGATGATCGTGATGGCTCTTCCAAGTCTGATCTGGAAGATTTCACAGGTTCCTGCACTAGCCTATCAGACCAGAATAACTCATGGCTACGAGATCATGATGAGACAGGCTCTGCTCACTCAGGTACACCGGGTCCTTCCAGCGGAAGACTAGCTTCCCAAAGTGGCGAATAATCCAGTGAACGGGGTGATTGTATGGGATAACAGTGGGGGCATCACCCCGCCCGGGGGGGATGATGAATGACTTAAAATAGAAAACAAGAA
Full Trace Sequence: GGTCTTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCACAAAGGTATGATGAGATGCTGCATTACCCAACGTTGGATGGGATGCCTCTGGCAGGATTTGGGGATGCACACACAGGCCGAGCACTACAGCACCACTCACTTAGCCAGAGTGCACCCTATGGATCTACAGGAGCAGGTCACCGAGTACCAATGCCCCCTGGAATGGGCAGCAACGATGGTCTGAAAAGAGAGAAGGATGAGATTTATGGGCACCCACTGTTTCCTCTGCTGGCTTTGGTGTTCGAGAAGTGCGAACTGGCTACGTGTTCCCCTCGTGACAATTCAGGGTCATTCCCAGGGGGCGATGTTTGCTCTTCAGATTCTTTTAATGAAGATATTGCTGTTTTTGCCAAACAGGTCAGAACAGAAAAACCCCTGTTCTCTTCCAACCCAGAGCTGGACAGTTTGATGATTCAAGCCATTCAAGTTTTACGATTCCACCTGTTGGAGTTAGAAAAGGTTCATGATCTGTGTGACAATTTCTGCCACCGGTATATCACATGTCTAAAAGGCAAGATGCCCATTGATTTAGTGATAGATGATCGTGATGGCTCTTCCAAGTCTGATCTGGAAGATTTCACAGGTTCCTGCACTAGCCTATCAGACCAGAATAACTCATGGCTACGAGATCATGATGAGACAGGCTCTGCTCACTCAGGTACACCGGGTCCTTCCAGCGGAAGACTAGCTTCCCAAAGTGGCGAATAATCCAGTGAACGGGGTGATTGTATGGGATAACAGTGGGGGCATCACCCCGCCCGGGGGGGATGATGAATGACTTAAAATAGAAAACAAGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACAAAGGTATGATGAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ834685
dbEST ID: 79652387
Trimmed Sequence: GTGAGCGTGAATGTCTATGTTTTGACCATTTAGAAGTGCGTCCGCCGGACTCTGCGCTGATACCAGGTGGTGAGGGGAGGCGCCAGCTGGCAGAATCATAGAGGCGTGGTGAGGGTGCCCTGGGAGGTAGGAGTGTAGAGACGGTCCGTGGCGAAGACCGGCGGAGTGTGGCGGTATGGCAGGTGTGTACCCAGCCGGTGGGAATCCCATGGGCATAGTGCTTGGGGCTGCTGTGTAATCCCCAGGAATTCCTTGGAAGCCAGGGGGTCGGATGCCCATGTGTTGTTGTCCATCCATGACATATCCTCCCATGTTCTGACCATCTGGACTGTAGGGAGCACCTCCTTGCCCTGTGCGATTAGATTGGTCAATCATAGGCTGGACAATGCGTCTTCTTGCATTAATAAACCAGTTGTTAACCTGTAATATCGTGAGCCCTGTATCCTGCGCTAGCTGCTTTTTCTGTTCTTCAGAGGGATAAGGGTGCGAGAGGTGCTGAAAGAGCCACGCCCTCATTATATTCGTGGCAACTTTGGGGAAAATGCCTCTTTTCTTGTTTCTCTTCTTGTCTCTATCTAAGTCATCATCATCCCCCGTGCTGGGTGATGCCACACTGTTATTCATACAATCACCCTTGTTCACTGGAATTATCCCCAACTTTTGGGAAAACTAGTCCTCCGCTGGAAAGGACCCGGTTGGTCCCTGAATTGAACCAAAACCCGGTCCCAACCATGGATCCTCCTTAAACCCCTTGAATTTAATTCCG
Full Trace Sequence: GGACAGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGAGCGTGAATGTCTATGTTTTGACCATTTAGAAGTGCGTCCGCCGGACTCTGCGCTGATACCAGGTGGTGAGGGGAGGCGCCAGCTGGCAGAATCATAGAGGCGTGGTGAGGGTGCCCTGGGAGGTAGGAGTGTAGAGACGGTCCGTGGCGAAGACCGGCGGAGTGTGGCGGTATGGCAGGTGTGTACCCAGCCGGTGGGAATCCCATGGGCATAGTGCTTGGGGCTGCTGTGTAATCCCCAGGAATTCCTTGGAAGCCAGGGGGTCGGATGCCCATGTGTTGTTGTCCATCCATGACATATCCTCCCATGTTCTGACCATCTGGACTGTAGGGAGCACCTCCTTGCCCTGTGCGATTAGATTGGTCAATCATAGGCTGGACAATGCGTCTTCTTGCATTAATAAACCAGTTGTTAACCTGTAATATCGTGAGCCCTGTATCCTGCGCTAGCTGCTTTTTCTGTTCTTCAGAGGGATAAGGGTGCGAGAGGTGCTGAAAGAGCCACGCCCTCATTATATTCGTGGCAACTTTGGGGAAAATGCCTCTTTTCTTGTTTCTCTTCTTGTCTCTATCTAAGTCATCATCATCCCCCGTGCTGGGTGATGCCACACTGTTATTCATACAATCACCCTTGTTCACTGGAATTATCCCCAACTTTTGGGAAAACTAGTCCTCCGCTGGAAAGGACCCGGTTGGTCCCTGAATTGAACCAAAACCCGGTCCCAACCATGGATCCTCCTTAAACCCCTTGAATTTAATTCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGAGCGTGAATGTCTATGT