ORFeome > metap1 ORF1 – XORFeome v1.0

metap1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: metap1
Gene ID: 985738
Gene Page ID: 985732
ORF Xenbase ID: 17283783

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054204
Original XGC clone length: 1158

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: C04

Sequences - 5ʹ (forward) EST

Accession: JZ839387
dbEST ID: 79657089
Trimmed Sequence: ATGGCGGCGGTGGAGAGCCGAGTGTGTGAGACTGAAGGCTGCAGCAGTGAGGCCAAACTGCAGTGTCCGACCTGCATCAAGCTGGGAATCCAAGGCTCCTACTTCTGCTCCCAGGAATGTTTCAAAGGAAGTTGGGTGACCCACAAGCTCCTTCACAAGAAAACAAAAGATGATAAAGTCAAACCTGAAGTCTCACCATGGACAATGGATGATGACGTAAATACAGATCCTTGGCCAGGTTATCGATATACTGGTAAGCTGAGGCCACATTATCCATTGACTCCAATGAGACCAGTAACAAACCACATACAGAGGCCAGATTATGCAGATCATCCTTTAGGAATGTCTGAATCTGAACAGACTTTGAAGGGTACCTCTCAAATAAAAGTCCTTTCTCCAGAAGATATAGAAGGAATGCGGGTTGTTTGCAGACTTGCTAGGGAGGTGTTGGGAGTGGCTGCCATGATGGTAAAACCTGGTATCACAACAAAAGAGATAGACCATGCGGTACATTTGGCCTGTATTTCAAGAAGCTGTTATCCATCCCCACTGAATTATTATAATTTTCCTAAATCCTGCTGCACCTCGCTAAATGAGATCATCTGCCATGGGATTCCAGACAGGAAGGCCTTTGCAGGATGGTGAAATTTGAAATGTGGATATTACAGTTTATAAAAATGGAAATCATGGAAAACTTAATGGAACCCTTTTATTTTGGTGGTTTGGGTGGGGGGGGGCAAAAAAACTTCCTCAAACCACCCTTCCGAAACCCCCCAACTCCCCCCCCTCCGCATGGACGGCCTGAACCAAAGGTGAT
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGGTGGAGAGCCGAGTGTGTGAGACTGAAGGCTGCAGCAGTGAGGCCAAACTGCAGTGTCCGACCTGCATCAAGCTGGGAATCCAAGGCTCCTACTTCTGCTCCCAGGAATGTTTCAAAGGAAGTTGGGTGACCCACAAGCTCCTTCACAAGAAAACAAAAGATGATAAAGTCAAACCTGAAGTCTCACCATGGACAATGGATGATGACGTAAATACAGATCCTTGGCCAGGTTATCGATATACTGGTAAGCTGAGGCCACATTATCCATTGACTCCAATGAGACCAGTAACAAACCACATACAGAGGCCAGATTATGCAGATCATCCTTTAGGAATGTCTGAATCTGAACAGACTTTGAAGGGTACCTCTCAAATAAAAGTCCTTTCTCCAGAAGATATAGAAGGAATGCGGGTTGTTTGCAGACTTGCTAGGGAGGTGTTGGGAGTGGCTGCCATGATGGTAAAACCTGGTATCACAACAAAAGAGATAGACCATGCGGTACATTTGGCCTGTATTTCAAGAAGCTGTTATCCATCCCCACTGAATTATTATAATTTTCCTAAATCCTGCTGCACCTCGCTAAATGAGATCATCTGCCATGGGATTCCAGACAGGAAGGCCTTTGCAGGATGGTGAAATTTGAAATGTGGATATTACAGTTTATAAAAATGGAAATCATGGAAAACTTAATGGAACCCTTTTATTTTGGTGGTTTGGGTGGGGGGGGGCAAAAAAACTTCCTCAAACCACCCTTCCGAAACCCCCCAACTCCCCCCCCTCCGCATGGACGGCCTGAACCAAAGGTGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGGTGGAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839386
dbEST ID: 79657088
Trimmed Sequence: AGAGAGAAAATAAGGGCGTCCATTTTCTTCAAGTCTACGTGTTAGAATCTCACAGCCAGTCTCTGTGATTAAAAGAGTATGCTCAAACTGTGCTGATCTTTTCCCATCTCTCGTTACTGCAGTCCAACCATCAGGCCAAGTCTCGTCTTGCCATCCTCCTTCACAAATCATTGGCTCAATTGTAAAGACGTGACCTGGCTTCATAACGCCAACAGCCTTGTTTTTGGCATAATGTGGCACATTTGGAGTAGTATGGAAAAGCTTGTGGATGCCATGTCCGCAATAGCTTCGAACAACAGAAAATCCATTTGCTTGTGCATGTTTTTGGATGATGTTCCCAAGCTCTCTGTATCGGACACCTGGTTTCACTTCATCTATAGCTTGCATTAGGCACTCGTATGTTGTCTCAACAAGTCTCTTCGCTCCCTCATCCACATCCCCAACATAAAAGGTCTCATTAAGATCTCCATGATATCCATCTCTATNAACTGTAATATCCACATTTACAATATCACCATCTTGCAAAGGCCTCCTGTCTGGAATCCCATGGCAGATGATCTCATTTACCGAGGTGCAGCAGGATTTAGGAAAATTATAATAATTTAATTGGGGAAGGATAACAGCTTCTTGAAAATACAGGCAAAATGGACCGCAGGGTCTATCTCCTTCGGTTGGGATACCCGGGTTTTACCATCAGGGGCGCCCACTCCCAAACCCCTCCCCAAGCCAGGCCCGGGAAAACAACCCCCACATTCCTTTCTAAATTTTTTCTG
Full Trace Sequence: GCAGCGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGAGAGAAAATAAGGGCGTCCATTTTCTTCAAGTCTACGTGTTAGAATCTCACAGCCAGTCTCTGTGATTAAAAGAGTATGCTCAAACTGTGCTGATCTTTTCCCATCTCTCGTTACTGCAGTCCAACCATCAGGCCAAGTCTCGTCTTGCCATCCTCCTTCACAAATCATTGGCTCAATTGTAAAGACGTGACCTGGCTTCATAACGCCAACAGCCTTGTTTTTGGCATAATGTGGCACATTTGGAGTAGTATGGAAAAGCTTGTGGATGCCATGTCCGCAATAGCTTCGAACAACAGAAAATCCATTTGCTTGTGCATGTTTTTGGATGATGTTCCCAAGCTCTCTGTATCGGACACCTGGTTTCACTTCATCTATAGCTTGCATTAGGCACTCGTATGTTGTCTCAACAAGTCTCTTCGCTCCCTCATCCACATCCCCAACATAAAAGGTCTCATTAAGATCTCCATGATATCCATCTCTATNAACTGTAATATCCACATTTACAATATCACCATCTTGCAAAGGCCTCCTGTCTGGAATCCCATGGCAGATGATCTCATTTACCGAGGTGCAGCAGGATTTAGGAAAATTATAATAATTTAATTGGGGAAGGATAACAGCTTCTTGAAAATACAGGCAAAATGGACCGCAGGGTCTATCTCCTTCGGTTGGGATACCCGGGTTTTACCATCAGGGGCGCCCACTCCCAAACCCCTCCCCAAGCCAGGCCCGGGAAAACAACCCCCACATTCCTTTCTAAATTTTTTCTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAGAGAAAATAAGGGCGTCCA