ORFeome > metap2 ORF1 – XORFeome v1.0

metap2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: metap2
Gene ID: 1010155
Gene Page ID: 1010149
ORF Xenbase ID: 17283795

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC122516
Original XGC clone length: 1446

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ838157
dbEST ID: 79655859
Trimmed Sequence: ATGGCGGGTTTAGTGGTAAAGCTGCAGAGCCCCGAACAGGAGGAAGAGGATGGGGAAAAACACATGAACGGTGTGGTGGAGGAGAACGAAGCCGCCTTTCCGGGAGAGAATAGCGTGAGCAAAAAAAAGAGGAAAAAGAAAAAGAAGAACAACGCCAAAACAGGACATGATGCTGAAAAAGACGGGGCTATAGCCAAAGCCACTGAAGAAATCGCAACACAACTGGAGAAGCAGACAATGGAAAATAAAGAAAAAGATGAAGATGAAGAAGATGGTGAAGGTGATGCTGATGGAGCAGCTGGGAAGAAGAATAAAAAAAACAATAAGAAAGGATCAAAATCACAAACCGATCCACCCTCTATTGCAATATCTGAACTCTATCCGAGTGGAATATTTCCAAAAGGACAGGAGTGCGAGTACCCTGCAACACAAGATGGACGATCTGCAGCTTGGAGAGCAACAAGTGAATATAAAAAAGCTATGGATCAACCTAATGAGGAGGTCTGGACTGATGTCAGACAAGCACCTGAACCTCCCAGACAAGTGAAGAGATATGTGATGAACTGCATCAAGCCTGGAATGACCGTGATTGACATAATTAAAAACTTCGAGGACTTTTCCGTCAGCTGATTAGGGAAGGGGGGGTGAGTGCTGTACTGGGGTTCCCCGAACCTTTTGTATTGAGTTGGTGGAGGGGGGCGACTACACACACCGATCTCANGTAATCCAACGGTTAGTTGGGTTATTGATGTTGAGCTGGGTAAAGTGGTATTTTAGTCACCCT
Full Trace Sequence: CCGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGGTTTAGTGGTAAAGCTGCAGAGCCCCGAACAGGAGGAAGAGGATGGGGAAAAACACATGAACGGTGTGGTGGAGGAGAACGAAGCCGCCTTTCCGGGAGAGAATAGCGTGAGCAAAAAAAAGAGGAAAAAGAAAAAGAAGAACAACGCCAAAACAGGACATGATGCTGAAAAAGACGGGGCTATAGCCAAAGCCACTGAAGAAATCGCAACACAACTGGAGAAGCAGACAATGGAAAATAAAGAAAAAGATGAAGATGAAGAAGATGGTGAAGGTGATGCTGATGGAGCAGCTGGGAAGAAGAATAAAAAAAACAATAAGAAAGGATCAAAATCACAAACCGATCCACCCTCTATTGCAATATCTGAACTCTATCCGAGTGGAATATTTCCAAAAGGACAGGAGTGCGAGTACCCTGCAACACAAGATGGACGATCTGCAGCTTGGAGAGCAACAAGTGAATATAAAAAAGCTATGGATCAACCTAATGAGGAGGTCTGGACTGATGTCAGACAAGCACCTGAACCTCCCAGACAAGTGAAGAGATATGTGATGAACTGCATCAAGCCTGGAATGACCGTGATTGACATAATTAAAAACTTCGAGGACTTTTCCGTCAGCTGATTAGGGAAGGGGGGGTGAGTGCTGTACTGGGGTTCCCCGAACCTTTTGTATTGAGTTGGTGGAGGGGGGCGACTACACACACCGATCTCANGTAATCCAACGGTTAGTTGGGTTATTGATGTTGAGCTGGGTAAAGTGGTATTTTAGTCACCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGTTTAGTGGTA

Sequences - 3ʹ (reverse) EST

Accession: JZ838156
dbEST ID: 79655858
Trimmed Sequence: ATAGTCATCTCCTCTGCTCACAACTTCTTTGCAGTTTGGGCGCAGTAATATTGTGTGCTCAAACTGTGCTGTGTATGAGCCCTTCATATCACAGAGAGGCGGGTACGGGTCGACTATACCCAAATCACACAGGTTCTTCAGGGCCATCAGGTATTTACTCTCTCCAAGACGGTCCAGCCATCTACGGCAGAATGCCAGGGTACCAAATTTCTCATTGATGACATTCAGCAAGTGTTTTGCTCGAGGAAGTCTTATTGGCACATGTCCCACATCAAAGTTCTTCATATAGTGGGAACACTCCATATCATCATGAACTACTCCTTTTCCAGTGCTACCAAATGTTTCTATCGCATACACCTCTCCTTCCTCCATTCTTGTTGCTTCTCCACCTTTCACAATGGGCACAGTTTTACCAGCATGAATTCTGTATGGTCCAATGGAATGGCCATTTACATTTCGAATTGGTTTAACTTGATACGTTTTGCCATCAATTTCAACCTCATATGACTCCATAACCTCTTGAATTGCCTCACCGACATCACAAAAACCACATTCATGCCTGAAAACGTTATTCCGTGTTGGTGGCATCCTTTACCGCTCCAGCCATTTGTCCTATTTTGGATTAGAGGGTGACTGAAGAAGCAAGTCAATTTATTCGGCAATTAAAATGGGGTTCCAAGTGTCAATTTGCCGAAATTCATTCCAATTTGAAAAACTGGTGAGATCCCGCTGCGTTTTAGGTTTTTGTAAGGTGGGCGGGCGCG
Full Trace Sequence: GGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAGTCATCTCCTCTGCTCACAACTTCTTTGCAGTTTGGGCGCAGTAATATTGTGTGCTCAAACTGTGCTGTGTATGAGCCCTTCATATCACAGAGAGGCGGGTACGGGTCGACTATACCCAAATCACACAGGTTCTTCAGGGCCATCAGGTATTTACTCTCTCCAAGACGGTCCAGCCATCTACGGCAGAATGCCAGGGTACCAAATTTCTCATTGATGACATTCAGCAAGTGTTTTGCTCGAGGAAGTCTTATTGGCACATGTCCCACATCAAAGTTCTTCATATAGTGGGAACACTCCATATCATCATGAACTACTCCTTTTCCAGTGCTACCAAATGTTTCTATCGCATACACCTCTCCTTCCTCCATTCTTGTTGCTTCTCCACCTTTCACAATGGGCACAGTTTTACCAGCATGAATTCTGTATGGTCCAATGGAATGGCCATTTACATTTCGAATTGGTTTAACTTGATACGTTTTGCCATCAATTTCAACCTCATATGACTCCATAACCTCTTGAATTGCCTCACCGACATCACAAAAACCACATTCATGCCTGAAAACGTTATTCCGTGTTGGTGGCATCCTTTACCGCTCCAGCCATTTGTCCTATTTTGGATTAGAGGGTGACTGAAGAAGCAAGTCAATTTATTCGGCAATTAAAATGGGGTTCCAAGTGTCAATTTGCCGAAATTCATTCCAATTTGAAAAACTGGTGAGATCCCGCTGCGTTTTAGGTTTTTGTAAGGTGGGCGGGCGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAGTCATCTCCTCTGCTCACAA