ORFeome > mfap2 ORF1 – XORFeome v1.0

mfap2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mfap2
Gene ID: 6254690
Gene Page ID: 6257613
ORF Xenbase ID: 17283891

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041238
Original XGC clone length: 582

Human orthology & disease relationships

NCBI Entrez ID: 4237
Ensembl gene IDs: ENSG00000117122
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 129600,154700,182212,608328

Library Location

Plate ID: GDExl11008
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ823643
dbEST ID: 79641345
Trimmed Sequence: ATGAGGTCGGTGTGTCTCCTCCTACTCTGTTTACAAGGGATATTTGCTCAGCTGGAAACGGACCCTCTCTTCCCGTATGACAACAACCCAGATATCCCCAATTATTACTATTATGATGGAGACACAACCGGAACTCCTTTCCAGCCCCCAGACCAAGTTCATCAGCAGAACCCACAACAACAGCAGTTGCAGCTGCAGCTTGACCCAATTGAACAGGAACCTCAGCAGCAGCAGCAGCTTCAGCAACAGCAAGAGATCATCGCTGTGCCCACCCTGGACCCCGCTGTGACTGAGCCGACAGAGCCGGGACCTCTGGATTGTCGGGAGGAGCAGTATCCATGTACCCGTCTGTACTCAGTACACAAACCCTGCAAGCAGTGCCTGAATCAAATCTGCTTCTATAGCCTGCGGCGCATGTACGTGGTCAATAAGGAAATCTGTGTCCGTACAGTTTGTGCACACGAGGAGCTTCTGAGAGCGGATCTGTGCCGAGACAAGTTCTCTCGCTGTGGGGTGATGGCCAATAGTGGCCTGTGCCAATCAATGGGATCTCACTGCTCCAGGAGCTGCGGCAGCTGCTT
Full Trace Sequence: CAATACTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGTCGGTGTGTCTCCTCCTACTCTGTTTACAAGGGATATTTGCTCAGCTGGAAACGGACCCTCTCTTCCCGTATGACAACAACCCAGATATCCCCAATTATTACTATTATGATGGAGACACAACCGGAACTCCTTTCCAGCCCCCAGACCAAGTTCATCAGCAGAACCCACAACAACAGCAGTTGCAGCTGCAGCTTGACCCAATTGAACAGGAACCTCAGCAGCAGCAGCAGCTTCAGCAACAGCAAGAGATCATCGCTGTGCCCACCCTGGACCCCGCTGTGACTGAGCCGACAGAGCCGGGACCTCTGGATTGTCGGGAGGAGCAGTATCCATGTACCCGTCTGTACTCAGTACACAAACCCTGCAAGCAGTGCCTGAATCAAATCTGCTTCTATAGCCTGCGGCGCATGTACGTGGTCAATAAGGAAATCTGTGTCCGTACAGTTTGTGCACACGAGGAGCTTCTGAGAGCGGATCTGTGCCGAGACAAGTTCTCTCGCTGTGGGGTGATGGCCAATAGTGGCCTGTGCCAATCAATGGGATCTCACTGCTCCAGGAGCTGCGGCAGCTGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATTAGTGAGTCGTATACATGGGTCATAGCTGTTTCCTGGAGCTCTGGCGTGAAAATAAAAAAAAAAATAAAAAAAAAAAAAAAAAAAAAAAAATAATTTTAAAATAATAATTTTTTTTTTTTTTTTTAAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGTCGGTGTGTCTCCTCCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ828949
dbEST ID: 79646651
Trimmed Sequence: GCAGCTGCCGCAGCTCCTGGAGCAGTGAGATCCCATTGATTGGCACAGGCCACTATTGGCCATCACCCCACAGCGAGAGAACTTGTCTCGGCACAGATCCGCTCTCAGAAGCTCCTCGTGTGCACAAACTGTACGGACACAGATTTCCTTATTGACCACGTACATGCGCCGCAGGCTATAGAAGCAGATTTGATTCAGGCACTGCTTGCAGGGTTTGTGTACTGAGTACAGACGGGTACATGGATACTGCTCCTCCCGACAATCCAGAGGTCCCGGCTCTGTCGGCTCAGTCACAGCGGGGTCCAGGGTGGGCACAGCGATGATCTCTTGCTGTTGCTGAAGCTGCTGCTGCTGCTGAGGTTCCTGTTCAATTGGGTCAAGCTGCAGCTGCAACTGCTGTTGTTGTGGGTTCTGCTGATGAACTTGGTCTGGGGGCTGGAAAGGAGTTCCGGTTGTGTCTCCATCATAATAGTAATAATTGGGGATATCTGGGTTGTTGTCATACGGGAAGAGAGGGTCCGTTTCCAGCTGAGCAAATATCCCTTGTAAACAGAGTACGAGGAGACACACCGACCTCAGGG
Full Trace Sequence: AGGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAGCTGCCGCAGCTCCTGGAGCAGTGAGATCCCATTGATTGGCACAGGCCACTATTGGCCATCACCCCACAGCGAGAGAACTTGTCTCGGCACAGATCCGCTCTCAGAAGCTCCTCGTGTGCACAAACTGTACGGACACAGATTTCCTTATTGACCACGTACATGCGCCGCAGGCTATAGAAGCAGATTTGATTCAGGCACTGCTTGCAGGGTTTGTGTACTGAGTACAGACGGGTACATGGATACTGCTCCTCCCGACAATCCAGAGGTCCCGGCTCTGTCGGCTCAGTCACAGCGGGGTCCAGGGTGGGCACAGCGATGATCTCTTGCTGTTGCTGAAGCTGCTGCTGCTGCTGAGGTTCCTGTTCAATTGGGTCAAGCTGCAGCTGCAACTGCTGTTGTTGTGGGTTCTGCTGATGAACTTGGTCTGGGGGCTGGAAAGGAGTTCCGGTTGTGTCTCCATCATAATAGTAATAATTGGGGATATCTGGGTTGTTGTCATACGGGAAGAGAGGGTCCGTTTCCAGCTGAGCAAATATCCCTTGTAAACAGAGTACGAGGAGACACACCGACCTCAGGGTGCCAACTTTTTTGTACAAAGTTGGGATTATAAAAAAGCATTGCTCATCAGTTTGTTGCCAACGACAGGGCACTATCAATCAAAATAAAAATCATAATTAGCGGTCCCGAGCTGAGAACTGGCCGCGTTCGCCGCGCTTCCTTCGTGTCAGGGGGGAATTTACTCGCGCAAAAAATTTACGGGNCNTGTTTAACG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGCTGCCGCAGCTCC