ORFeome > mfap4 ORF1 – XORFeome v1.0

mfap4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mfap4
Gene ID: 997608
Gene Page ID: 997604
ORF Xenbase ID: 17283903

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129662
Original XGC clone length: 765

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ838645
dbEST ID: 79656347
Trimmed Sequence: ATGAAGGCACTCTGGGCCCTTGGGCACATCGCTCTCTTACTGTTGGCTTGTGACTCAGTTTGGAGTCGGATATCCAAGCGAGAGCCAGAGAATGATTCTGAGCAGTTCCCTGCAGACTGTGAGGAGGTACATGATGCAGGAGCAGAAGCCGATGGGGTATATGTCATCTACCCTGCTGGATCCTCAAGTGCTGTGCCCGTATACTGTGACATGACTACTGATGGTGGGAAGTGGACAGTGATCCAGAGAAGGTTTAATGGCACCCTGAGTTTTTTCCGTGGCTGGATTGACTATAAATTGGGGTTCGGTCGAGCAGATGAAGAATATTGGCTTGGACTGCACAATATTTACCAGCTAACATTGAGGAGGAAGTATGAGTTGAGGATCGAACTGGGAGACTTTGAGAACAACATGACCCATGCTAAATATGGGGACTTCTCCCTCTGCCCCAAAGCCATTAAACCCAGAGGAAGATGGCTACACTTTGTATGTGGAAGATTTCGCTGATGGAGGAGCAAGGGACTCTCTGACCTATCACAACGGGATGGAGTTTTCCGCCTACGACGGAGATCGGGGATACTTACCAGCAAAAATGTTGCTTCCGTCTCTGCTGGCGGCTTTCCGGTTCAAAGCTTGGTCACTGGGAGAATCTGAATGGAACAATACATGGCGTGGTGTTCGACTAGTCCCATGGGAATTAGCGTCGTCAGGGTGGAAAAGGAAAGGGTCTTTAACAAGGTCACTTAAAAAGAGGCAAGAATAAAAAAAGGAGACGTGGGTGT
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGCACTCTGGGCCCTTGGGCACATCGCTCTCTTACTGTTGGCTTGTGACTCAGTTTGGAGTCGGATATCCAAGCGAGAGCCAGAGAATGATTCTGAGCAGTTCCCTGCAGACTGTGAGGAGGTACATGATGCAGGAGCAGAAGCCGATGGGGTATATGTCATCTACCCTGCTGGATCCTCAAGTGCTGTGCCCGTATACTGTGACATGACTACTGATGGTGGGAAGTGGACAGTGATCCAGAGAAGGTTTAATGGCACCCTGAGTTTTTTCCGTGGCTGGATTGACTATAAATTGGGGTTCGGTCGAGCAGATGAAGAATATTGGCTTGGACTGCACAATATTTACCAGCTAACATTGAGGAGGAAGTATGAGTTGAGGATCGAACTGGGAGACTTTGAGAACAACATGACCCATGCTAAATATGGGGACTTCTCCCTCTGCCCCAAAGCCATTAAACCCAGAGGAAGATGGCTACACTTTGTATGTGGAAGATTTCGCTGATGGAGGAGCAAGGGACTCTCTGACCTATCACAACGGGATGGAGTTTTCCGCCTACGACGGAGATCGGGGATACTTACCAGCAAAAATGTTGCTTCCGTCTCTGCTGGCGGCTTTCCGGTTCAAAGCTTGGTCACTGGGAGAATCTGAATGGAACAATACATGGCGTGGTGTTCGACTAGTCCCATGGGAATTAGCGTCGTCAGGGTGGAAAAGGAAAGGGTCTTTAACAAGGTCACTTAAAAAGAGGCAAGAATAAAAAAAGGAGACGTGGGTGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGCACTCTGGGC

Sequences - 3ʹ (reverse) EST

Accession: JZ838644
dbEST ID: 79656346
Trimmed Sequence: CACACGTCGTATCTTCATCTCGGTACTTTTAAGGGAGTAGTAAAGACCCCTCCATTCAGACCAGATGACGCCACTCCCATAGGACAGGTGGACACCACGCAGGTATGGTCCATTCAGATTAGCCAGGTGACAAGCTCTGAACCAGAAGCCGCCAGCAGAGAGGGAAGCACAGTTTTGCTGGTAAGTATCCCGATCTCTGTCGTAGGTGGAAAACTTCATCCCGTTGTGATAGGTCAGAGAGTCCCCTGCTCCTCCATCAGTGAAATCTTCCACATACAAAGTGTAGCCATCTTCCTCTGGGTTAATGGCTTTGGGGCAGAGGGAGAAGTCCCCATATTTAGCATGGGTCATGTTGTTCTCAAAGTCTCCCAGTTCGATCCTCAACTCATACTTCCTCCTCAATGTTAGCTGGTAAATATTGTGCAGTCCAAGCCAATATTCTTCATCTGCTCGACCGAACCCCAATTTATAGTCAATCCAGCCACGGAGAAAACTCAGGGTGCCATTAAACCTTCTCTGGATCACTGTCCACTTCCCACCATCAGTAGTCATGTCACAGTATACGGGCACAGCACTTGAGGATCCAACAGGGGTAGATGACATATACCCCCATCCGGCCTCTGCTCCTGGCTCAGGGACCTCCTCCACAGTCTGCAGGGGACCTGCTCCAAAACCCTTTCTCTGGGCTCTCCCTGGGGATATCCCGAATCCCCACCTTGAATCCCAACGCCCAACAGTAAAAAAAGCGGAAGGTGCCCAAGGGGCCCCCAAAAGTGCCCGTC
Full Trace Sequence: GAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACACGTCGTATCTTCATCTCGGTACTTTTAAGGGAGTAGTAAAGACCCCTCCATTCAGACCAGATGACGCCACTCCCATAGGACAGGTGGACACCACGCAGGTATGGTCCATTCAGATTAGCCAGGTGACAAGCTCTGAACCAGAAGCCGCCAGCAGAGAGGGAAGCACAGTTTTGCTGGTAAGTATCCCGATCTCTGTCGTAGGTGGAAAACTTCATCCCGTTGTGATAGGTCAGAGAGTCCCCTGCTCCTCCATCAGTGAAATCTTCCACATACAAAGTGTAGCCATCTTCCTCTGGGTTAATGGCTTTGGGGCAGAGGGAGAAGTCCCCATATTTAGCATGGGTCATGTTGTTCTCAAAGTCTCCCAGTTCGATCCTCAACTCATACTTCCTCCTCAATGTTAGCTGGTAAATATTGTGCAGTCCAAGCCAATATTCTTCATCTGCTCGACCGAACCCCAATTTATAGTCAATCCAGCCACGGAGAAAACTCAGGGTGCCATTAAACCTTCTCTGGATCACTGTCCACTTCCCACCATCAGTAGTCATGTCACAGTATACGGGCACAGCACTTGAGGATCCAACAGGGGTAGATGACATATACCCCCATCCGGCCTCTGCTCCTGGCTCAGGGACCTCCTCCACAGTCTGCAGGGGACCTGCTCCAAAACCCTTTCTCTGGGCTCTCCCTGGGGATATCCCGAATCCCCACCTTGAATCCCAACGCCCAACAGTAAAAAAAGCGGAAGGTGCCCAAGGGGCCCCCAAAAGTGCCCGTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACACGTCGTATCTTCATCT