ORFeome > mfsd5 ORF1 – XORFeome v1.0

mfsd5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mfsd5
Gene ID: 967136
Gene Page ID: 967130
ORF Xenbase ID: 17283957

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124899
Original XGC clone length: 1356

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ838769
dbEST ID: 79656471
Trimmed Sequence: ATGTTGGTTACGGCATACTTGTTTCTCTTGGGGCTGTTAGCTCTATGGGGCGTGTTGGAGTTCTCTGCCTGTCATTCTAAGCCATCAGCCTCCAGCAATGCACTGGGAAACCCTGCCTTTCGACAGTTTCAATATGACTTCTATAGAACTTATTTCCCAGCTCTGGCTGCGGATTGGTTGCAGGGCCCCTACCTGTACAAATTGTACCAGCACTACCACTTCCTGGAGGGACAAATCGCAATCATCTATGTCTGCGGCTTTGGGGCTAGTGTGTTTGCAGGTCTAGTGAGCGTCCCGCTGACAAGTCGACTTGGTCGCAGGAAATCCTGCATTCTGTTTTGCCTTCTCCTCTCAGCGAGCTACCTGTGCAAGCTGTCTCAAGAATATTTTGTGCTTATGACTGGAAGGGTTTTGGGTGGCTTTTCAAGCTCTTTACTCTTTTCTTGCTTTGAAGCATGGTACACCCATGAACACGCTGAGCAACATGATTTTCCAGCTGAGTGGCTCCCTCACACCTTCACTCGGGCAGCTGCCTGGAACGGAGGCATAGCAATAGCTGCAGGGAATAACTGCAATGTCTGTGCAGAGTGGCTAAGTCTTGGTCCTGCTTCACCTCCCTGCCTGCCGTGCCCCTCCTTGTTTTATCTGTATTCCTAGTGAACCGTGAATGGGATGAAAATTTAGGAAAAAACCATTACCTTTCGAAATAATGTGGAAAGGAAATGGCGTGTCTTTCGAAAAAACTACAGGAGGCCTGCTTTGGGGTACACCTCCCAAGCTTAATTTTAAAAAGGGAAATTTTAAAAATTTTCCTCCTTC
Full Trace Sequence: CGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGGTTACGGCATACTTGTTTCTCTTGGGGCTGTTAGCTCTATGGGGCGTGTTGGAGTTCTCTGCCTGTCATTCTAAGCCATCAGCCTCCAGCAATGCACTGGGAAACCCTGCCTTTCGACAGTTTCAATATGACTTCTATAGAACTTATTTCCCAGCTCTGGCTGCGGATTGGTTGCAGGGCCCCTACCTGTACAAATTGTACCAGCACTACCACTTCCTGGAGGGACAAATCGCAATCATCTATGTCTGCGGCTTTGGGGCTAGTGTGTTTGCAGGTCTAGTGAGCGTCCCGCTGACAAGTCGACTTGGTCGCAGGAAATCCTGCATTCTGTTTTGCCTTCTCCTCTCAGCGAGCTACCTGTGCAAGCTGTCTCAAGAATATTTTGTGCTTATGACTGGAAGGGTTTTGGGTGGCTTTTCAAGCTCTTTACTCTTTTCTTGCTTTGAAGCATGGTACACCCATGAACACGCTGAGCAACATGATTTTCCAGCTGAGTGGCTCCCTCACACCTTCACTCGGGCAGCTGCCTGGAACGGAGGCATAGCAATAGCTGCAGGGAATAACTGCAATGTCTGTGCAGAGTGGCTAAGTCTTGGTCCTGCTTCACCTCCCTGCCTGCCGTGCCCCTCCTTGTTTTATCTGTATTCCTAGTGAACCGTGAATGGGATGAAAATTTAGGAAAAAACCATTACCTTTCGAAATAATGTGGAAAGGAAATGGCGTGTCTTTCGAAAAAACTACAGGAGGCCTGCTTTGGGGTACACCTCCCAAGCTTAATTTTAAAAAGGGAAATTTTAAAAATTTTCCTCCTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGGTTACGGCATACTTGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838768
dbEST ID: 79656470
Trimmed Sequence: CTCGGTTCCATTAGGTTCCGGCTCAGAGGCTGGAAGCCTTAATTCAGAGTCATTTCTCACCATTGTGAAGAGGCTTACCACACAGAGCAGGGCAAGTAGCATTGTGACGGCACACAAACTGAACATGTTCCTGGTACCACTTTGGTAGTCACTGTCATGCAGTACAAGTAGCCCTAATCCAGCGAGCAGGTTTAGAGGAACTCTGAACCAGTTCAATACACCTGTCTGCTCTTTCTCTGGAATTAACCTGCGCCTCAGGAATCGCATGGCAGGAAAGTAGAGGCCGCAAGCCAACTCAATGAGCAGAAATGCCAGCAAGGACTCTGTTGGATGCTCTTGGCCTGGAGCAGTGGAGAATGTCAGCATGAAGAGAGAAAAGAACACCATAAGAATTGAGAGACAAAGGACATGCATTGGCTGCAAATGGTATTTCTTGGAAGTTGCAAGATGATACAGTGAGGATCCCACTGCACTAGCTGCCATAAAGCTAGAAAAGGCAATGCCAAGAGGTGCATTATGTGGATCCAGTACTGGTGTCCAAAGGAAGATGAATATATAAACTACACTCTCAAATAAAGCTTGGATGGTACCCAAAAGCAGCACCCGTCGATCTCTCAGAAGACACCGCANTCCATCTCCACATACTCTCCGAAAGCCTACTGGTCTGTCCATAATTTTCATCCCACTCACGTATCAATAGGACTACGAATAAAACAAAGGAGGGGCACGGGCAAGCACGGGAAAGGGTGAAACCAGGGACCAAGAAAC
Full Trace Sequence: AAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCGGTTCCATTAGGTTCCGGCTCAGAGGCTGGAAGCCTTAATTCAGAGTCATTTCTCACCATTGTGAAGAGGCTTACCACACAGAGCAGGGCAAGTAGCATTGTGACGGCACACAAACTGAACATGTTCCTGGTACCACTTTGGTAGTCACTGTCATGCAGTACAAGTAGCCCTAATCCAGCGAGCAGGTTTAGAGGAACTCTGAACCAGTTCAATACACCTGTCTGCTCTTTCTCTGGAATTAACCTGCGCCTCAGGAATCGCATGGCAGGAAAGTAGAGGCCGCAAGCCAACTCAATGAGCAGAAATGCCAGCAAGGACTCTGTTGGATGCTCTTGGCCTGGAGCAGTGGAGAATGTCAGCATGAAGAGAGAAAAGAACACCATAAGAATTGAGAGACAAAGGACATGCATTGGCTGCAAATGGTATTTCTTGGAAGTTGCAAGATGATACAGTGAGGATCCCACTGCACTAGCTGCCATAAAGCTAGAAAAGGCAATGCCAAGAGGTGCATTATGTGGATCCAGTACTGGTGTCCAAAGGAAGATGAATATATAAACTACACTCTCAAATAAAGCTTGGATGGTACCCAAAAGCAGCACCCGTCGATCTCTCAGAAGACACCGCANTCCATCTCCACATACTCTCCGAAAGCCTACTGGTCTGTCCATAATTTTCATCCCACTCACGTATCAATAGGACTACGAATAAAACAAAGGAGGGGCACGGGCAAGCACGGGAAAGGGTGAAACCAGGGACCAAGAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCGGTTCCATTAGGTTC