ORFeome > mfsd7 ORF1 – XORFeome v1.0

mfsd7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mfsd7
Gene ID: 6255873
Gene Page ID: 5740365
ORF Xenbase ID: 17283975

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC129637
Original XGC clone length: 1455

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ837871
dbEST ID: 79655573
Trimmed Sequence: ATGGCTGAGGAGGAGCTGTGGAATGTTCCTACCCAGTCGGAGAAGGAAGCTCAACAGGCTTGGCATTCATCTCTGGCCAAATTCAGGGTATAATCTACATGATACTCTTTCAAAAACTCACCCGGCCGTTCGCTCCTTCTGAACCTTCTCCGTGCGGAATACATCAGACTGAAATATATGACTGGTCAATTTCCATGTTAGTGATGGCCGCTTTGTGCACCTTTGGCTCCTGCATCTTTATCATCTTCTTTCATACGGATTACAAGCGGCTCCGGGCAGAAAGAAATTTAAACATATTAAAAGAAGAATTGGATGGAAGTGCAACATT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGGAGGAGCTGTGGAATGTTCCTACCCAGTCGGAGAAGGAAGCTCAACAGGCTTGGCATTCATCTCTGGCCAAATTCAGGGTATAATCTACATGATACTCTTTCAAAAACTCACCCGGCCGTTCGCTCCTTCTGAACCTTCTCCGTGCGGAATACATCAGACTGAAATATATGACTGGTCAATTTCCATGTTAGTGATGGCCGCTTTGTGCACCTTTGGCTCCTGCATCTTTATCATCTTCTTTCATACGGATTACAAGCGGCTCCGGGCAGAAAGAAATTTAAACATATTAAAAGAAGAATTGGATGGAAGTGCAACATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCAAAAATCACAAGATCAGAATCTCATATCTTACATGCGTAAGGCCCCCCTGAAAAAAAAAGAAGCACCTCAAAAAACCCAGGGTTCTCGGGTTAACTTCTCTTGTCAAAGAAAAAAACCCACAACAAAAAAAATCCCCGGGGGTGTTTTTAAATTTGGAGAGGAAGGGCGGGGGGGGCGCCCACCCTGGGGGAAAAAAATTTAAAGAAAAACAAAGGGGGGTGTGGGGCCAAGGGCGCTGTTTTTTTGGTTTTTATAAAATCTTTTTTTATTTGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGGAGGAGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ837870
dbEST ID: 79655572
Trimmed Sequence: TGTTGCACTTCCATCCAATTCTTCTTTTAATATGTTTAAATTTCTTTCTGCCCGGAGCCGCTTGTAATCCGTATGAAAGAAGATGATAAAGATGCAGGAGCCAAAGGTGCACAAAGCGGCCATCACTAACATGGAAATTGACCAGTCATATATTTCAGTCTGATGTATTCCGCACGGAGAAGGTTCAGAAGGAGCGAACGGCCGGGTGAGTTTTTGAAAGAGTATCATGTAGATTATACCCTGAATTTGGCCAGAGATGAATGCCAAGCCTGTTGAGCTTCCTTCTCCGACTGGGTAGGAACATTCCACAGCTCCTCCTCAGCCATGG
Full Trace Sequence: GGGCCAGGGGAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTTGCACTTCCATCCAATTCTTCTTTTAATATGTTTAAATTTCTTTCTGCCCGGAGCCGCTTGTAATCCGTATGAAAGAAGATGATAAAGATGCAGGAGCCAAAGGTGCACAAAGCGGCCATCACTAACATGGAAATTGACCAGTCATATATTTCAGTCTGATGTATTCCGCACGGAGAAGGTTCAGAAGGAGCGAACGGCCGGGTGAGTTTTTGAAAGAGTATCATGTAGATTATACCCTGAATTTGGCCAGAGATGAATGCCAAGCCTGTTGAGCTTCCTTCTCCGACTGGGTAGGAACATTCCACAGCTCCTCCTCAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGGCAAGACAAAAACAACATCTTAACTCAACAGCTCCAAATGCCAGGCCTCGAAGAAAAAAAAAAAAATCCCCCCCAAACAAGGGCTTTCCGTTAAAACTGATGGTTGAAGAGAACGACTAGACAAAAGAAAGAGGAACTGAGCGGGAGGGGGGTGTATATTGTAAGCACTGGTGCTAGGGGGACAACAAACCGGGACAAAAAAAGAAAAAACCCACGGGGGGGAAGGGGCGAAGGGGGATAAGAAGGGAGAGGAAGGGATGTGANGGNAAGAAGNGGNAGNGAGAAAAGGAGAGNGGGGGGGGGGGGAGAAGGANGAAAAGAGAAGAGGGNGNGNNGGNNNAAGAGGAGNCGAGNAANGAGGAAGGGAAAGNNNGGNGGNGAGGGNNGGNGGGAAGNAAGGGAGGGAGGGAAANGGAANGGAGGAAGGGGGAGGGGAGAGGGAGAAAGAANAAGGATGANGNAGGGAGGAGAAAGAGANAGAGGGGGGGAGGGNGNNGAAGAGGGNNGGNGGGNAANTNGGNGAAGGGNAAGAANNNAGAGGAAGNGGNGAGAGAAAGCNAGGAANNAGGGANNNNGNGGNAAGGAGANGGGNGNGGANNGTNGNNNGTTAANNGGGGCAGGNNANNGAGNNNGGNNGCGAAAAGAGGNGAGGGGAGGAGAAGAGAGAGTNNGAGNANGAGAGAGACNGGGNNAGNNGGAAGGNNNAGGGAAAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTTGCACTTCCATCCAATTCT