ORFeome > mgc107841 ORF1 – XORFeome v1.0

mgc107841 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mgc107841
Gene ID: 5779751
Gene Page ID: 5779683
ORF Xenbase ID: 17284017

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC112956
Original XGC clone length: 1764

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ837234
dbEST ID: 79654936
Trimmed Sequence: ATGCCTTTCTCCCATGCAGCAATAGGGAATTTTTTCCAAGAAAGACCTTCTTTAGGAAACCAATTCCTAGAGGATGCTCTGCTCCAAAGTTACATAAAGAGGCACCTCCCTCCTCAGATGGTCAGTGAGGTGAGTCAGGACTATATTCGCTTTGCTCAGCGCTTAGTGGAGGAAATTGATTCACTAGGAAGGGACTGTGAGCTGAATCTACCACGGTTACAACAATACGATGCCTGGGGCCGCAGGGTGGATCAGATTATTACCTGCTCGGCTTGGAAGAAAATGAAAGAAGTTTCAGCAGAGGAAGGCCTGGTTGCAGAAGCATATGAGAGAAGATATTCCAGCTGGAGTCGTCTTATACAGGTTATCAAGATCTATCTGTATTCTCCCTCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGAATGCCTACAATCATTTGACTTCACGAAATCCCAGCAGTTTCTGGACCTCTGGACAGTGGATGACAGAACGTAGAGGAGGTTCAGATGTAGCGGTTGGTACAGAAACCATTGCACACAGACAGGAAGATGGCACATACAGGTTACATGGATACAGGTGGTTTACGTCTGCCATCGACTCAAACATGAACCTTGGCCTTGGGCCAGAATAGTGGAACACCGTGGGAACCCCGGGGGTCGGGAAGTGGGGGGATTCTCTCTGATTTAT
Full Trace Sequence: CGAGGCACCATATAANTGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTTTCTCCCATGCAGCAATAGGGAATTTTTTCCAAGAAAGACCTTCTTTAGGAAACCAATTCCTAGAGGATGCTCTGCTCCAAAGTTACATAAAGAGGCACCTCCCTCCTCAGATGGTCAGTGAGGTGAGTCAGGACTATATTCGCTTTGCTCAGCGCTTAGTGGAGGAAATTGATTCACTAGGAAGGGACTGTGAGCTGAATCTACCACGGTTACAACAATACGATGCCTGGGGCCGCAGGGTGGATCAGATTATTACCTGCTCGGCTTGGAAGAAAATGAAAGAAGTTTCAGCAGAGGAAGGCCTGGTTGCAGAAGCATATGAGAGAAGATATTCCAGCTGGAGTCGTCTTATACAGGTTATCAAGATCTATCTGTATTCTCCCTCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGAATGCCTACAATCATTTGACTTCACGAAATCCCAGCAGTTTCTGGACCTCTGGACAGTGGATGACAGAACGTAGAGGAGGTTCAGATGTAGCGGTTGGTACAGAAACCATTGCACACAGACAGGAAGATGGCACATACAGGTTACATGGATACAGGTGGTTTACGTCTGCCATCGACTCAAACATGAACCTTGGCCTTGGGCCAGAATAGTGGAACACCGTGGGAACCCCGGGGGTCGGGAAGTGGGGGGATTCTCTCTGATTTAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTTTCTCCCATGCAGCAA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAATTTTCCTTTTAAAAGAGGGCTATTGTCATACACTAACTGTCTGTCTAGGGACATTGACTCAGAGTCATAACAGCCTGATGCCTTGGCTTTATCCACGGGGCAGAGATCCTGGTCACTCCACCTCTGAGCAGAGTAGATGTCTGTGGCAGATGCTCCTTCCCAGGCTGCATGGGACAAAAGCATGGTGCCAACATTTATGTAAACCATGCTGAATACAAAATCTCATGCATCAACTTCTTTATACTTCCCACCGATCTCTCCCACTTCTTGCAGTGAACAGCCATAAGTTTGTTTAACGCTTTAATAGTGTGCATTGCAGCATGCCACAACCTGGGGACACACGATGCACGATCCAGTTTTTCCTGGGCAGTTGAAAAGAAAACACTGAGCACTTTCCCATTGCTCTCGATGACCGACCGAAGTACATCTTAACACAACATGTTTGTTGTCCCTTCCCAGATAATCAGAACCTGAACATGTCTAAGCCTAAGAGGCAGGCCTGATTCATACGTGTGACGGAGTCGCGCGGAGCGTTACAAACCCTCTCATATAACTGGCAAGAGCATGTTTGCCTGTGGAAATTTTAACTACAGTGGTGAGTAGGTCAAACAAAAAACCAAATCCTGGTTCTGTCCCCGAGGTGAAATTTCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATTTTCCTTTTAAAAGAGGGCT