ORFeome > MGC115496 ORF1 – XORFeome v1.0

MGC115496 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6254280
Gene Page ID:
ORF Xenbase ID: 17257101

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC099022
Original XGC clone length: 1410

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ838367
dbEST ID: 79656069
Trimmed Sequence: ATGCCCGGACCCAGCACCCTGGCCAACCTGGTGGAGTTTTTCTGGCGTGATGGGTTCGGCCGCATCCATGAGATTCAGCAAAAGCACACGCGCCAGTATGGCCGGATATTCAAGTCACACTTTGGACCTCAGTTTGTGGTTTCCATCGCTGACAAAGACTTGGTCGCCCAGGTGATCAGAGCAGAGAGAGATGCCCCCCAGAGGGCCAACATGGAGTCCTGGCACGAGTATAGAGAATTAAGAGGCCGATCCACTGGACTAATTTCTGCGGAAGGGGAGAAGTGGTTAAACATGCGAAGTGTCTTGCGGCAGAAGATTCTCCGGCCAAGGGATGTGGCCATGTATACTGGAGGGGTAAATGAGGTCATTGGTGACCTGGTAAAGAAGATCCACAAACTCCGAGCCCAGGAAAGTGATGGACTGACTGTGACCAATGTTAATGATCTGTACTTCAAGTACTCCATGGAAGCTATTGCCACAGTCCTGTATGAGTGCCGCCTCGGGTGCTTGGATGACATAATCCCTCAGCAGACCAAGGAATACATTGCAGCTCTGGAACTCATGTTCAGCATGTTCAAAACAACCATGTACGCCGGCGCCATCCCAAAATGGTTACGCACCATAATTCCCAAACCGTGGAAGAGATTTTTGCAGGTCCTGGGATGGACTCTTTAAATTCAATCAGCTCCCACTAAACCACAGAATGAAGCAGATTGAATTCCCACCTGGAATAAAGGGGGA
Full Trace Sequence: GGGGGCCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCGGACCCAGCACCCTGGCCAACCTGGTGGAGTTTTTCTGGCGTGATGGGTTCGGCCGCATCCATGAGATTCAGCAAAAGCACACGCGCCAGTATGGCCGGATATTCAAGTCACACTTTGGACCTCAGTTTGTGGTTTCCATCGCTGACAAAGACTTGGTCGCCCAGGTGATCAGAGCAGAGAGAGATGCCCCCCAGAGGGCCAACATGGAGTCCTGGCACGAGTATAGAGAATTAAGAGGCCGATCCACTGGACTAATTTCTGCGGAAGGGGAGAAGTGGTTAAACATGCGAAGTGTCTTGCGGCAGAAGATTCTCCGGCCAAGGGATGTGGCCATGTATACTGGAGGGGTAAATGAGGTCATTGGTGACCTGGTAAAGAAGATCCACAAACTCCGAGCCCAGGAAAGTGATGGACTGACTGTGACCAATGTTAATGATCTGTACTTCAAGTACTCCATGGAAGCTATTGCCACAGTCCTGTATGAGTGCCGCCTCGGGTGCTTGGATGACATAATCCCTCAGCAGACCAAGGAATACATTGCAGCTCTGGAACTCATGTTCAGCATGTTCAAAACAACCATGTACGCCGGCGCCATCCCAAAATGGTTACGCACCATAATTCCCAAACCGTGGAAGAGATTTTTGCAGGTCCTGGGATGGACTCTTTAAATTCAATCAGCTCCCACTAAACCACAGAATGAAGCAGATTGAATTCCCACCTGGAATAAAGGGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCGGACCCAGCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838366
dbEST ID: 79656068
Trimmed Sequence: CTGCCTGTCCAAAAAACGCACGTTGATCTTTTCCCCTGGACACAGAAGCCCATGGGTTTTTGGGAGAACAGTCATTGTTTCAGGTGACAACTTGATCTCAAAATTTTGAAGAAGCTGGATCAGCAACAGATGGATCTCCAGTTCTGCGACTCTCCGGCCAATGCAGCTGCGGATTCCGTTGCCAAATGGGATGGAACCAAAGTTCTCCTTCCGTTCCAGGTACCCACTGCGTATCCAACGCTCCGGTTTGAACTCTTCTGCTCCCGGGAAGCATTTGTCATCATAGGATGTGGAATAATGACAGAGTGCCAACTGGGTCCCTTTAGGGATTAAATATCCATCCAAAACCAAGTCATCTTGTGTCACTCTGCCGTTCCCGGGCAAGACAGGGAAGAGTCTCAAGGTTTCCTTGACAACAGCTCTGACCATGGGGATTTTGGTAACATCTTCTGCGGTAGGAACCTGGTCTTTTCCCAAGTTCTGCACGATCTGCTGATACACGCTCTCCTGGATACTGGGGTTCTTTGCCAGCAGATATGTTGCCCAGGAGAGAGTAAAGGAAGTCGTGTCAACACCAGCCAGGAGCATTTCCGTCATATTGCCATAAATCTCTTCCAAGTCCAACTCTTTTGGAAACCAAAAGGGTGGTTAGAAACTCCCCCTTGTACCTGTTCCCCCTTATCCCCCCTGGGAAATCAATCGGGCCACAATCCGTTGGGTCTAACGGGGAACCTAA
Full Trace Sequence: GGGAATATGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGCCTGTCCAAAAAACGCACGTTGATCTTTTCCCCTGGACACAGAAGCCCATGGGTTTTTGGGAGAACAGTCATTGTTTCAGGTGACAACTTGATCTCAAAATTTTGAAGAAGCTGGATCAGCAACAGATGGATCTCCAGTTCTGCGACTCTCCGGCCAATGCAGCTGCGGATTCCGTTGCCAAATGGGATGGAACCAAAGTTCTCCTTCCGTTCCAGGTACCCACTGCGTATCCAACGCTCCGGTTTGAACTCTTCTGCTCCCGGGAAGCATTTGTCATCATAGGATGTGGAATAATGACAGAGTGCCAACTGGGTCCCTTTAGGGATTAAATATCCATCCAAAACCAAGTCATCTTGTGTCACTCTGCCGTTCCCGGGCAAGACAGGGAAGAGTCTCAAGGTTTCCTTGACAACAGCTCTGACCATGGGGATTTTGGTAACATCTTCTGCGGTAGGAACCTGGTCTTTTCCCAAGTTCTGCACGATCTGCTGATACACGCTCTCCTGGATACTGGGGTTCTTTGCCAGCAGATATGTTGCCCAGGAGAGAGTAAAGGAAGTCGTGTCAACACCAGCCAGGAGCATTTCCGTCATATTGCCATAAATCTCTTCCAAGTCCAACTCTTTTGGAAACCAAAAGGGTGGTTAGAAACTCCCCCTTGTACCTGTTCCCCCTTATCCCCCCTGGGAAATCAATCGGGCCACAATCCGTTGGGTCTAACGGGGAACCTAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGCCTGTCCAAAAAACGCAC