ORFeome > MGC115587 ORF1 – XORFeome v1.0

MGC115587 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 6488706
Gene Page ID: 5772073
ORF Xenbase ID: 17257143

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097845
Original XGC clone length: 1161

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: G04

Sequences - 5ʹ (forward) EST

Accession: JZ837120
dbEST ID: 79654822
Trimmed Sequence: ATGACTGAGAAGGACAAGGATGTCTGGCAGGAGGACCCCGCGGAATACTGTCCAGGTGGTTACCACCCAGTGCAATCTGGAGATATGCTGAACAGAAGATACCAAGCCATTCACAAGGTGGGATGGGGCTACTTCTCTACTGTTTGGCTGTGTCACGATTTACAAAAAAAGAAGAAGGTGGCAGTGAAAATTTCCAAAAGTGGACGAAGGTTCAGCGAAGCGGCCCTGGATGAAATCTCTATTCTTAATTGTGTAAATGGTGCACGGAAGAAAGAGTCTCAAGGGGAGAATGTCATCCAGCTTTTAGATGACTTTAAATTGATCGGAGAAAACGGCCTCCATGTGTGTCTGGTATTTGAATTGCTGGGACCATCTCTCCTGCATTTAATGAGGAATCACGGCCCGGAAGGCCTGCCTCTAACGTGTGTGCGTAGGGTTCTCCAGCAGGTGCTGCAAGGCCTTAACTTTCTTCACAAGAGGTGCCGCATTATCCATACAGACATCAAACCAGAAAACATCCTTGTGTGTGTGAAGGCGGACAATCTGCAGCAGTGCATGGCTGAAGCTGCTATCTGGAGCCAGATAAAGCTGGTGACCGTACGGAGCAGGGGTGTTGATGTGAACTTCCTAACTCACCTGCTTGATACTGGAAATTCCGACATGCTTGGAGTGAAGATCGCAAAACCTGACAACAATTTCTGGACTTGGTATGGCTTTTCTTAGAAAATCCAAACCCACAATAAAAGGCCCCCGGGAGGTGGGTTTTGGGCTCGCCCTAGAGCAGTTTCTTTTAAAATAGGGGGGCAAAGGAGCGGGC
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTGAGAAGGACAAGGATGTCTGGCAGGAGGACCCCGCGGAATACTGTCCAGGTGGTTACCACCCAGTGCAATCTGGAGATATGCTGAACAGAAGATACCAAGCCATTCACAAGGTGGGATGGGGCTACTTCTCTACTGTTTGGCTGTGTCACGATTTACAAAAAAAGAAGAAGGTGGCAGTGAAAATTTCCAAAAGTGGACGAAGGTTCAGCGAAGCGGCCCTGGATGAAATCTCTATTCTTAATTGTGTAAATGGTGCACGGAAGAAAGAGTCTCAAGGGGAGAATGTCATCCAGCTTTTAGATGACTTTAAATTGATCGGAGAAAACGGCCTCCATGTGTGTCTGGTATTTGAATTGCTGGGACCATCTCTCCTGCATTTAATGAGGAATCACGGCCCGGAAGGCCTGCCTCTAACGTGTGTGCGTAGGGTTCTCCAGCAGGTGCTGCAAGGCCTTAACTTTCTTCACAAGAGGTGCCGCATTATCCATACAGACATCAAACCAGAAAACATCCTTGTGTGTGTGAAGGCGGACAATCTGCAGCAGTGCATGGCTGAAGCTGCTATCTGGAGCCAGATAAAGCTGGTGACCGTACGGAGCAGGGGTGTTGATGTGAACTTCCTAACTCACCTGCTTGATACTGGAAATTCCGACATGCTTGGAGTGAAGATCGCAAAACCTGACAACAATTTCTGGACTTGGTATGGCTTTTCTTAGAAAATCCAAACCCACAATAAAAGGCCCCCGGGAGGTGGGTTTTGGGCTCGCCCTAGAGCAGTTTCTTTTAAAATAGGGGGGCAAAGGAGCGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTGAGAAGGACAAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837119
dbEST ID: 79654821
Trimmed Sequence: GCACTGGAGCCACGGGTGTTGAAGACACGTTTCAGCGGTTGCCCGTTTTTCACAGACATATTCCAGCATGGGCAGGAGAAAGCTGGCAAATGTAAGGGCCTCATTCTTCTGCCATCTGTGCCCTCTCACGAGGGTGTCGTAAAGCCCACAGGGGTACAGCTGAGGGATACGGAGCAGATCCCCTTGTTTATTGAAGAACGCAGGTGATTTTCTCCCAGAAGAAATAACTTTGGGTGGGATGCGCCCCAGCAGTTCCATTATACAGGCAATGTGATCATCCTCTCTGGTGAAGGTTTTTCCAGCGTGGGGCTCAAACAGATAGTATGACGTGGCCATTTCAAATGCCATGCAGGCTGTGCTCCATATATCCACAGAAGTGCTATAGGTTGAGCCCAAAAGAACCTCCGGTGCCCTGTACTGTTGGGTTTGGATTTCCTCAGAAAAGGCTTTATAAGTCCAGCAACTGCTGCCCAGGTCTGCGATTTTCACTCCCAGCATGTCGGAATTTCCAGTCTCAAACACGTGAGTTAGGAAGTTCACATCAACACCATGCTTCCTACAGGTCACGGGCTTTATTCTGGCTCCCGAAAACCACCTCGGCCATGCCCTGCTTGCGATGGTCCGCCTTGGCACCCACAAACAATATTTTTCTGGGTTTATTGCTGGGTTGAATAATGCCGCCGCCTCCTTTCTAACAAAAATTTAAAGCGTTGCC
Full Trace Sequence: GCGAAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATGCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCACTGGAGCCACGGGTGTTGAAGACACGTTTCAGCGGTTGCCCGTTTTTCACAGACATATTCCAGCATGGGCAGGAGAAAGCTGGCAAATGTAAGGGCCTCATTCTTCTGCCATCTGTGCCCTCTCACGAGGGTGTCGTAAAGCCCACAGGGGTACAGCTGAGGGATACGGAGCAGATCCCCTTGTTTATTGAAGAACGCAGGTGATTTTCTCCCAGAAGAAATAACTTTGGGTGGGATGCGCCCCAGCAGTTCCATTATACAGGCAATGTGATCATCCTCTCTGGTGAAGGTTTTTCCAGCGTGGGGCTCAAACAGATAGTATGACGTGGCCATTTCAAATGCCATGCAGGCTGTGCTCCATATATCCACAGAAGTGCTATAGGTTGAGCCCAAAAGAACCTCCGGTGCCCTGTACTGTTGGGTTTGGATTTCCTCAGAAAAGGCTTTATAAGTCCAGCAACTGCTGCCCAGGTCTGCGATTTTCACTCCCAGCATGTCGGAATTTCCAGTCTCAAACACGTGAGTTAGGAAGTTCACATCAACACCATGCTTCCTACAGGTCACGGGCTTTATTCTGGCTCCCGAAAACCACCTCGGCCATGCCCTGCTTGCGATGGTCCGCCTTGGCACCCACAAACAATATTTTTCTGGGTTTATTGCTGGGTTGAATAATGCCGCCGCCTCCTTTCTAACAAAAATTTAAAGCGTTGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCACTGGAGCCACGGGTGTT